Incidental Mutation 'R5016:Gpr19'
ID385575
Institutional Source Beutler Lab
Gene Symbol Gpr19
Ensembl Gene ENSMUSG00000032641
Gene NameG protein-coupled receptor 19
Synonyms
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134869093-134898578 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 134869917 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 231 (K231*)
Ref Sequence ENSEMBL: ENSMUSP00000149995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046255] [ENSMUST00000066107] [ENSMUST00000111932] [ENSMUST00000116515] [ENSMUST00000165392] [ENSMUST00000203409] [ENSMUST00000203762] [ENSMUST00000204880] [ENSMUST00000215088]
Predicted Effect probably null
Transcript: ENSMUST00000046255
AA Change: K182*
SMART Domains Protein: ENSMUSP00000047630
Gene: ENSMUSG00000032641
AA Change: K182*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 1.8e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066107
AA Change: K268*
SMART Domains Protein: ENSMUSP00000066287
Gene: ENSMUSG00000032641
AA Change: K268*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 5.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111932
AA Change: K176*
SMART Domains Protein: ENSMUSP00000107563
Gene: ENSMUSG00000032641
AA Change: K176*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116515
AA Change: K176*
SMART Domains Protein: ENSMUSP00000112214
Gene: ENSMUSG00000032641
AA Change: K176*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165392
AA Change: K176*
SMART Domains Protein: ENSMUSP00000127876
Gene: ENSMUSG00000032641
AA Change: K176*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203409
SMART Domains Protein: ENSMUSP00000145128
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 132 9e-5 PFAM
Pfam:7tm_1 76 135 2.6e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203762
Predicted Effect probably null
Transcript: ENSMUST00000204880
SMART Domains Protein: ENSMUSP00000144918
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
transmembrane domain 59 76 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215088
AA Change: K231*
Meta Mutation Damage Score 0.688 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased anxiety-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Gpr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpr19 APN 6 134869742 missense probably damaging 0.99
IGL01373:Gpr19 APN 6 134870321 missense possibly damaging 0.81
IGL01988:Gpr19 APN 6 134869284 missense probably damaging 1.00
R1530:Gpr19 UTSW 6 134869998 missense probably damaging 0.97
R1548:Gpr19 UTSW 6 134870084 missense possibly damaging 0.92
R1699:Gpr19 UTSW 6 134870229 missense possibly damaging 0.93
R2131:Gpr19 UTSW 6 134870442 start codon destroyed probably null 0.99
R6605:Gpr19 UTSW 6 134870435 missense probably benign 0.02
R7080:Gpr19 UTSW 6 134870456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGACAATGTTCATCGTCCTTC -3'
(R):5'- TTGTCGTGCTGCAGTTCACC -3'

Sequencing Primer
(F):5'- CCTTCTGGTAAAACAGGATTATGAGG -3'
(R):5'- TGCAGTTCACCACCGGGAG -3'
Posted On2016-05-10