Incidental Mutation 'R5016:Nxpe4'
ID385582
Institutional Source Beutler Lab
Gene Symbol Nxpe4
Ensembl Gene ENSMUSG00000044229
Gene Nameneurexophilin and PC-esterase domain family, member 4
Synonyms
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48162023-48400025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48392885 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 91 (N91D)
Ref Sequence ENSEMBL: ENSMUSP00000149644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093853] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect probably benign
Transcript: ENSMUST00000093853
AA Change: N91D

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091375
Gene: ENSMUSG00000044229
AA Change: N91D

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Neurexophilin 74 272 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215780
AA Change: N91D

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216998
AA Change: N91D

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217002
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Nxpe4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nxpe4 APN 9 48394140 missense possibly damaging 0.63
IGL01723:Nxpe4 APN 9 48398598 missense probably benign 0.00
IGL03008:Nxpe4 APN 9 48393438 missense probably benign 0.01
IGL03022:Nxpe4 APN 9 48393248 missense probably damaging 0.99
IGL03271:Nxpe4 APN 9 48393045 missense probably damaging 0.99
R0633:Nxpe4 UTSW 9 48396597 missense probably benign
R1033:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R1186:Nxpe4 UTSW 9 48393392 missense probably benign 0.23
R1296:Nxpe4 UTSW 9 48396493 missense probably benign 0.00
R1596:Nxpe4 UTSW 9 48396555 missense probably damaging 0.97
R1813:Nxpe4 UTSW 9 48393378 missense possibly damaging 0.87
R2511:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R2902:Nxpe4 UTSW 9 48394146 missense probably benign 0.00
R4229:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4230:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4231:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4233:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4236:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4296:Nxpe4 UTSW 9 48398984 missense probably damaging 0.98
R5644:Nxpe4 UTSW 9 48392750 missense probably benign 0.00
R5797:Nxpe4 UTSW 9 48396538 missense possibly damaging 0.86
R5979:Nxpe4 UTSW 9 48396562 missense probably benign 0.02
R6170:Nxpe4 UTSW 9 48392804 missense probably benign 0.12
R6208:Nxpe4 UTSW 9 48393378 missense probably benign 0.12
R6431:Nxpe4 UTSW 9 48392845 missense probably damaging 0.99
X0062:Nxpe4 UTSW 9 48399025 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGGACCATGTTCAAGTTGC -3'
(R):5'- CTGACGAGGTAAGTGCCATTG -3'

Sequencing Primer
(F):5'- ACCATGTTCAAGTTGCCTGTG -3'
(R):5'- GAAGTCTGTCACCTTTCCAGAAG -3'
Posted On2016-05-10