Incidental Mutation 'R5016:Ezh1'
ID385587
Institutional Source Beutler Lab
Gene Symbol Ezh1
Ensembl Gene ENSMUSG00000006920
Gene Nameenhancer of zeste 1 polycomb repressive complex 2 subunit
Synonyms
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101191115-101226463 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 101199237 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100417] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect unknown
Transcript: ENSMUST00000100417
AA Change: P561S
SMART Domains Protein: ENSMUSP00000097984
Gene: ENSMUSG00000006920
AA Change: P561S

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 1.8e-20 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
PDB:4MI0|A 521 558 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146884
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the Polycomb-group (PcG) family. The encoded protein is interchangeable with the related Enhancer of zeste 2 (Ezh2) protein as a core component of the polycomb repressive complex 2 (PRC2), which methylates histone H3 at lysine 27 and results in the transcriptional repression of affected target genes. This complex is involved in carrying out cell-fate decisions during embryonic stem cell differentiation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and healthy. Mice homozygous for a conditional allele activated in hematopoietic stem cells exhibit bone marrow failure with defective HSC maintenance and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Ezh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ezh1 APN 11 101194506 unclassified probably null
IGL00481:Ezh1 APN 11 101199302 missense possibly damaging 0.68
IGL01327:Ezh1 APN 11 101203436 missense probably damaging 0.97
IGL01475:Ezh1 APN 11 101192961 missense probably damaging 1.00
IGL01693:Ezh1 APN 11 101215258 missense probably benign
IGL01896:Ezh1 APN 11 101213755 missense probably benign 0.00
IGL02022:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02024:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02028:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02053:Ezh1 APN 11 101199943 splice site probably benign
IGL02101:Ezh1 APN 11 101195566 missense possibly damaging 0.50
IGL02445:Ezh1 APN 11 101210687 missense possibly damaging 0.49
IGL02882:Ezh1 APN 11 101203289 missense probably benign 0.02
IGL03303:Ezh1 APN 11 101195671 unclassified probably null
IGL03493:Ezh1 APN 11 101203791 missense probably benign 0.02
R1099:Ezh1 UTSW 11 101193808 critical splice acceptor site probably null
R1119:Ezh1 UTSW 11 101210535 splice site probably benign
R1434:Ezh1 UTSW 11 101194917 missense probably damaging 1.00
R1477:Ezh1 UTSW 11 101192984 missense probably damaging 0.98
R2114:Ezh1 UTSW 11 101208185 missense probably benign 0.04
R3105:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R3106:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R4272:Ezh1 UTSW 11 101194908 missense probably damaging 1.00
R4820:Ezh1 UTSW 11 101203768 missense probably damaging 1.00
R5237:Ezh1 UTSW 11 101216993 critical splice donor site probably null
R6392:Ezh1 UTSW 11 101203804 missense probably damaging 0.96
R6892:Ezh1 UTSW 11 101199361 nonsense probably null
R7215:Ezh1 UTSW 11 101215299 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTTGTGACCTCAGGAGTTG -3'
(R):5'- TTGTTGCAACAATGTCCTGCTC -3'

Sequencing Primer
(F):5'- TTCTTGGACAACAGGCATGC -3'
(R):5'- GTTGCAACAATGTCCTGCTCTTTTC -3'
Posted On2016-05-10