Incidental Mutation 'R5016:Drd3'
ID385595
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Namedopamine receptor D3
SynonymsD3 receptor, D3R
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location43754026-43822932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43762246 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 34 (A34E)
Ref Sequence ENSEMBL: ENSMUSP00000155033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023390
AA Change: A2E

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: A2E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229953
AA Change: A34E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1310:Drd3 UTSW 16 43821529 missense probably damaging 0.96
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R3753:Drd3 UTSW 16 43817103 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6052:Drd3 UTSW 16 43821283 missense probably benign 0.01
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7031:Drd3 UTSW 16 43762498 missense probably damaging 0.98
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCACAGTCATATTATCCTGG -3'
(R):5'- GCAGCATGTACCATAAGCCC -3'

Sequencing Primer
(F):5'- ATTCCCATAGAGGCTTCCTAAGGG -3'
(R):5'- CGGCATCACCAAAGTGGC -3'
Posted On2016-05-10