Incidental Mutation 'R5016:Ptprs'
ID385599
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56419070 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 998 (D998G)
Ref Sequence ENSEMBL: ENSMUSP00000084038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]
Predicted Effect probably damaging
Transcript: ENSMUST00000067538
AA Change: D1404G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: D1404G

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086828
AA Change: D998G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: D998G

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223706
Predicted Effect probably damaging
Transcript: ENSMUST00000223859
AA Change: D994G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224522
Predicted Effect probably benign
Transcript: ENSMUST00000224777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225379
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACATTTGATCTGCCAGAC -3'
(R):5'- ATTGAGGCAGGAGTATGGCC -3'

Sequencing Primer
(F):5'- AACGCCTTGGAAGCCTC -3'
(R):5'- TGTCTGACTGCCACAGTGG -3'
Posted On2016-05-10