Incidental Mutation 'R5016:Slc22a19'
ID385600
Institutional Source Beutler Lab
Gene Symbol Slc22a19
Ensembl Gene ENSMUSG00000024757
Gene Namesolute carrier family 22 (organic anion transporter), member 19
SynonymsOat5, D630043A20Rik, Slc22a9
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7673061-7711310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7674372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 490 (T490M)
Ref Sequence ENSEMBL: ENSMUSP00000025666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025666]
Predicted Effect probably benign
Transcript: ENSMUST00000025666
AA Change: T490M

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025666
Gene: ENSMUSG00000024757
AA Change: T490M

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sugar_tr 103 528 6.3e-22 PFAM
Pfam:MFS_1 122 378 2.4e-20 PFAM
Pfam:MFS_1 377 549 1.7e-10 PFAM
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A24 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Slc22a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Slc22a19 APN 19 7682958 missense probably benign 0.00
IGL01126:Slc22a19 APN 19 7674283 missense possibly damaging 0.65
IGL01349:Slc22a19 APN 19 7674427 missense probably benign 0.36
IGL01409:Slc22a19 APN 19 7711130 missense probably benign 0.00
IGL01529:Slc22a19 APN 19 7682935 missense probably damaging 0.97
IGL03382:Slc22a19 APN 19 7681862 missense probably benign 0.01
R0269:Slc22a19 UTSW 19 7709621 splice site probably benign
R0464:Slc22a19 UTSW 19 7682913 missense probably benign 0.44
R1866:Slc22a19 UTSW 19 7711141 missense probably damaging 1.00
R1975:Slc22a19 UTSW 19 7683859 splice site probably benign
R2184:Slc22a19 UTSW 19 7709661 missense probably benign
R2226:Slc22a19 UTSW 19 7683850 missense possibly damaging 0.92
R2894:Slc22a19 UTSW 19 7692804 missense probably benign 0.43
R4751:Slc22a19 UTSW 19 7691145 missense possibly damaging 0.65
R5026:Slc22a19 UTSW 19 7674372 missense probably benign 0.07
R5108:Slc22a19 UTSW 19 7711171 missense probably benign
R5149:Slc22a19 UTSW 19 7711138 missense probably damaging 1.00
R5714:Slc22a19 UTSW 19 7711022 missense probably damaging 0.98
R6062:Slc22a19 UTSW 19 7674282 missense probably damaging 1.00
R6091:Slc22a19 UTSW 19 7711063 missense probably benign 0.26
R6982:Slc22a19 UTSW 19 7682969 missense probably benign 0.08
X0026:Slc22a19 UTSW 19 7710858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAGTGAGAATGTGGCC -3'
(R):5'- TCCCTAAGTCAATTACACAGCTCATTG -3'

Sequencing Primer
(F):5'- AGAATGTGGCCCTGAATTCTC -3'
(R):5'- GTCAATTACACAGCTCATTGACTTG -3'
Posted On2016-05-10