Incidental Mutation 'R0423:Ppip5k2'
ID38561
Institutional Source Beutler Lab
Gene Symbol Ppip5k2
Ensembl Gene ENSMUSG00000040648
Gene Namediphosphoinositol pentakisphosphate kinase 2
SynonymsHisppd1, Vip2
MMRRC Submission 038625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R0423 (G1)
Quality Score162
Status Validated
Chromosome1
Chromosomal Location97706048-97770411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97761427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000108466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]
Predicted Effect probably benign
Transcript: ENSMUST00000042509
AA Change: S44P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: S44P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112845
AA Change: S38P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 6.9e-141 PFAM
low complexity region 993 1006 N/A INTRINSIC
low complexity region 1192 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171129
AA Change: S38P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
A630001G21Rik A G 1: 85,726,466 I50T probably benign Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gfra2 C T 14: 70,896,081 T117M probably damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mcm3ap G A 10: 76,502,705 G1389D probably benign Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spag6 A G 2: 18,710,593 D61G probably benign Het
Spen T A 4: 141,479,336 N660I unknown Het
Sptan1 T G 2: 30,028,672 C2246G probably null Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in Ppip5k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Ppip5k2 APN 1 97713123 missense probably damaging 1.00
IGL02266:Ppip5k2 APN 1 97733972 missense possibly damaging 0.68
IGL02705:Ppip5k2 APN 1 97759199 missense probably damaging 1.00
IGL03229:Ppip5k2 APN 1 97728961 missense probably damaging 1.00
P0033:Ppip5k2 UTSW 1 97717528 missense probably damaging 0.98
R0082:Ppip5k2 UTSW 1 97759332 nonsense probably null
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0267:Ppip5k2 UTSW 1 97728997 missense probably damaging 1.00
R0281:Ppip5k2 UTSW 1 97716553 missense possibly damaging 0.95
R0373:Ppip5k2 UTSW 1 97740537 nonsense probably null
R0402:Ppip5k2 UTSW 1 97719854 missense probably benign 0.00
R0613:Ppip5k2 UTSW 1 97752740 nonsense probably null
R0751:Ppip5k2 UTSW 1 97749652 nonsense probably null
R1121:Ppip5k2 UTSW 1 97756860 missense probably damaging 1.00
R1265:Ppip5k2 UTSW 1 97719900 missense probably benign 0.00
R1436:Ppip5k2 UTSW 1 97711782 missense probably benign 0.04
R1543:Ppip5k2 UTSW 1 97740882 missense probably damaging 1.00
R1739:Ppip5k2 UTSW 1 97728957 missense probably damaging 1.00
R1845:Ppip5k2 UTSW 1 97723806 missense possibly damaging 0.74
R2191:Ppip5k2 UTSW 1 97744110 missense probably damaging 0.99
R2430:Ppip5k2 UTSW 1 97735030 missense probably damaging 1.00
R2762:Ppip5k2 UTSW 1 97717509 missense probably damaging 1.00
R3014:Ppip5k2 UTSW 1 97744075 missense probably damaging 0.99
R3759:Ppip5k2 UTSW 1 97755885 critical splice donor site probably null
R4603:Ppip5k2 UTSW 1 97755136 missense probably damaging 1.00
R4772:Ppip5k2 UTSW 1 97721067 unclassified probably benign
R4951:Ppip5k2 UTSW 1 97711749 missense possibly damaging 0.77
R5348:Ppip5k2 UTSW 1 97747592 missense possibly damaging 0.94
R5350:Ppip5k2 UTSW 1 97721128 missense probably damaging 0.98
R5584:Ppip5k2 UTSW 1 97750641 missense probably damaging 1.00
R5599:Ppip5k2 UTSW 1 97740598 missense probably damaging 1.00
R5883:Ppip5k2 UTSW 1 97707810 missense possibly damaging 0.53
R5898:Ppip5k2 UTSW 1 97744162 intron probably benign
R6184:Ppip5k2 UTSW 1 97734005 missense possibly damaging 0.89
R6221:Ppip5k2 UTSW 1 97730028 missense probably damaging 1.00
R6775:Ppip5k2 UTSW 1 97719860 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATAGTCTCTGCCTGAGGGCAAGG -3'
(R):5'- CATGCGATTGGGTGAAAACACTGC -3'

Sequencing Primer
(F):5'- CACATGCAGCCTTTGAGATAGTC -3'
(R):5'- GAGAATGTGCTCTTCTGACACC -3'
Posted On2013-05-23