Incidental Mutation 'S24628:Ugt1a10'
ID385644
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene NameUDP glycosyltransferase 1 family, polypeptide A10
SynonymsA13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #S24628 () of strain waterfowl
Quality Score153
Status Not validated
Chromosome1
Chromosomal Location88055388-88219004 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTCATCA to TTCA at 88216158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073049
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 88055987 missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 88056058 missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 88055863 missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 88055879 missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R0201:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 88056095 missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 88055609 missense probably benign
R1207:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88216260 missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 88055711 missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 88055981 missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 88055947 missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 88056210 missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 88055995 missense probably benign
R4474:Ugt1a10 UTSW 1 88215928 intron probably benign
R4476:Ugt1a10 UTSW 1 88215928 intron probably benign
R4515:Ugt1a10 UTSW 1 88056197 missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 88056116 missense probably benign
R4582:Ugt1a10 UTSW 1 88055741 missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 88055482 start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88218390 missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 88056287 missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88215928 intron probably benign
R4910:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 88055924 missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 88056252 splice site probably null
R5168:Ugt1a10 UTSW 1 88055809 missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6646:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6703:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6727:Ugt1a10 UTSW 1 88056257 splice site probably null
R6809:Ugt1a10 UTSW 1 88055925 missense probably damaging 0.98
X0013:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 88055842 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACATCTTAGCTTGATTGTGGTCCG -3'
(R):5'- ACCTACCTCTTGTTGTTGATGACAG -3'

Sequencing Primer
(F):5'- GTGGTCCGTACACATAAGACATTGC -3'
(R):5'- GATGACAGTTTTAAGGGCATTTTCC -3'
Posted OnMay 10, 2016