Incidental Mutation 'S24628:Olfr1023'
ID385645
Institutional Source Beutler Lab
Gene Symbol Olfr1023
Ensembl Gene ENSMUSG00000050128
Gene Nameolfactory receptor 1023
SynonymsMOR196-3, GA_x6K02T2Q125-47363965-47364900
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85886802-85887737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85887438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 213 (I213F)
Ref Sequence ENSEMBL: ENSMUSP00000059849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056408] [ENSMUST00000213441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056408
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059849
Gene: ENSMUSG00000050128
AA Change: I213F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.6e-7 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082871
Predicted Effect possibly damaging
Transcript: ENSMUST00000213441
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Olfr1023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Olfr1023 APN 2 85887600 missense probably damaging 1.00
IGL01622:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01623:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01977:Olfr1023 APN 2 85887367 missense probably damaging 1.00
IGL02057:Olfr1023 APN 2 85886931 missense probably benign 0.00
IGL02555:Olfr1023 APN 2 85887398 missense probably benign 0.34
IGL03133:Olfr1023 APN 2 85887134 missense probably damaging 1.00
IGL03180:Olfr1023 APN 2 85887396 missense probably benign 0.00
R0415:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
R1476:Olfr1023 UTSW 2 85887248 nonsense probably null
R1544:Olfr1023 UTSW 2 85887271 missense probably damaging 1.00
R2058:Olfr1023 UTSW 2 85886952 missense possibly damaging 0.48
R4096:Olfr1023 UTSW 2 85887423 missense probably damaging 0.98
R5055:Olfr1023 UTSW 2 85887241 missense probably benign 0.12
R5703:Olfr1023 UTSW 2 85887439 missense probably benign 0.06
R6297:Olfr1023 UTSW 2 85886815 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GAATGGGCTGTCTCAGACTCTG -3'
(R):5'- GATCAAGGGGTTCAACATTGG -3'

Sequencing Primer
(F):5'- GGCTGTCTCAGACTCTGCTCAC -3'
(R):5'- TGCAATTACTTTTGACTCTTCTACAG -3'
Posted OnMay 10, 2016