Incidental Mutation 'S24628:Olfr1034'
ID385646
Institutional Source Beutler Lab
Gene Symbol Olfr1034
Ensembl Gene ENSMUSG00000102091
Gene Nameolfactory receptor 1034
SynonymsGA_x6K02T2Q125-47521463-47522395, MOR227-8P, MOR227-8P, Olfr1533-ps1, MOR245-14P
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86045861-86050742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86047055 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 191 (H191L)
Ref Sequence ENSEMBL: ENSMUSP00000150150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079298] [ENSMUST00000213496] [ENSMUST00000213865] [ENSMUST00000214546] [ENSMUST00000215682] [ENSMUST00000218397]
Predicted Effect probably benign
Transcript: ENSMUST00000079298
AA Change: H191L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: H191L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213364
Predicted Effect probably benign
Transcript: ENSMUST00000213496
AA Change: H191L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000213865
Predicted Effect probably benign
Transcript: ENSMUST00000214546
Predicted Effect probably benign
Transcript: ENSMUST00000215682
Predicted Effect probably benign
Transcript: ENSMUST00000218397
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Olfr1034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr1034 APN 2 86046652 missense possibly damaging 0.55
IGL01066:Olfr1034 APN 2 86047258 missense probably damaging 0.97
IGL01326:Olfr1034 APN 2 86047283 missense probably damaging 0.96
IGL02862:Olfr1034 APN 2 86047304 missense probably benign 0.07
ANU74:Olfr1034 UTSW 2 86047311 nonsense probably null
R0415:Olfr1034 UTSW 2 86047055 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046587 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046934 missense possibly damaging 0.81
R0517:Olfr1034 UTSW 2 86047204 missense probably damaging 0.99
R0519:Olfr1034 UTSW 2 86047067 missense probably benign
R0619:Olfr1034 UTSW 2 86047311 nonsense probably null
R1015:Olfr1034 UTSW 2 86047082 missense possibly damaging 0.49
R1592:Olfr1034 UTSW 2 86046989 missense probably benign 0.00
R1598:Olfr1034 UTSW 2 86047313 missense probably damaging 0.99
R2062:Olfr1034 UTSW 2 86046955 missense probably damaging 1.00
R4690:Olfr1034 UTSW 2 86046898 missense probably damaging 1.00
R5757:Olfr1034 UTSW 2 86046566 missense possibly damaging 0.93
R5991:Olfr1034 UTSW 2 86046910 missense probably benign 0.05
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6760:Olfr1034 UTSW 2 86047014 nonsense probably null
R6852:Olfr1034 UTSW 2 86046604 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GTGATGGCCTTTGATCGCTAC -3'
(R):5'- TGGATACAGCTGTTAAGTGGGATC -3'

Sequencing Primer
(F):5'- CCCTTTGTTGTACAGCAGCAAGATG -3'
(R):5'- GATCCACAGGTAGAGAATGCCTTTC -3'
Posted On2016-05-10