Incidental Mutation 'S24628:Spint1'
ID385647
Institutional Source Beutler Lab
Gene Symbol Spint1
Ensembl Gene ENSMUSG00000027315
Gene Nameserine protease inhibitor, Kunitz type 1
SynonymsHAI-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119237362-119249527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119245615 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 231 (T231A)
Ref Sequence ENSEMBL: ENSMUSP00000106441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028783] [ENSMUST00000110816] [ENSMUST00000110817]
Predicted Effect probably damaging
Transcript: ENSMUST00000028783
AA Change: T231A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028783
Gene: ENSMUSG00000027315
AA Change: T231A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110816
AA Change: T231A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106440
Gene: ENSMUSG00000027315
AA Change: T231A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110817
AA Change: T231A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106441
Gene: ENSMUSG00000027315
AA Change: T231A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139903
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kunitz family of serine protease inhibitors. The protein is a potent inhibitor specific for HGF activator and is thought to be involved in the regulation of the proteolytic activation of HGF in injured tissues. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality at E10.5 or earlier, growth retardation, and widespread cell apoptosis. Placental development is impaired with abnormalities in branching morphogenesis, the formation of the labyrinth layer and placental function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Spint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Spint1 APN 2 119246455 missense probably damaging 1.00
IGL02065:Spint1 APN 2 119238217 missense probably benign 0.02
R0206:Spint1 UTSW 2 119248345 splice site probably benign
R0208:Spint1 UTSW 2 119248345 splice site probably benign
R0415:Spint1 UTSW 2 119245615 missense probably damaging 1.00
R0691:Spint1 UTSW 2 119246467 missense probably damaging 1.00
R1236:Spint1 UTSW 2 119245573 missense probably benign 0.05
R2190:Spint1 UTSW 2 119238180 missense probably benign 0.01
R3890:Spint1 UTSW 2 119248802 missense probably benign 0.28
R4599:Spint1 UTSW 2 119246460 missense probably damaging 1.00
R6280:Spint1 UTSW 2 119245278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GATATCCAGTCTGTGTGCTCTC -3'
(R):5'- TTCCTTGGGGTCGTAGTACC -3'

Sequencing Primer
(F):5'- TCTGTGTGCTCTCCCGGG -3'
(R):5'- TCGTAGTACCAGCGTGGG -3'
Posted On2016-05-10