Incidental Mutation 'S24628:Zfp282'
ID385655
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Namezinc finger protein 282
SynonymsHUB1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #S24628 () of strain waterfowl
Quality Score222
Status Not validated
Chromosome6
Chromosomal Location47877204-47908485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47905053 bp
ZygosityHomozygous
Amino Acid Change Isoleucine to Asparagine at position 558 (I558N)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061890
AA Change: I558N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: I558N

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47890120 missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47880277 missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47897914 missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47904797 small insertion probably benign
FR4589:Zfp282 UTSW 6 47904791 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904790 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904799 small insertion probably benign
FR4976:Zfp282 UTSW 6 47904790 small insertion probably benign
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47892932 missense probably benign 0.34
R0415:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
R0415:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
R0607:Zfp282 UTSW 6 47880369 missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47880384 missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47904599 missense probably benign 0.00
R1401:Zfp282 UTSW 6 47890174 nonsense probably null
R1572:Zfp282 UTSW 6 47892867 missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47897787 intron probably null
R2971:Zfp282 UTSW 6 47897932 splice site probably null
R4064:Zfp282 UTSW 6 47880094 missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47890696 nonsense probably null
R4530:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R4532:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R5068:Zfp282 UTSW 6 47877703 missense probably benign 0.01
R5261:Zfp282 UTSW 6 47897890 missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47905327 missense probably benign
R5551:Zfp282 UTSW 6 47890645 missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47880168 missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47880385 missense probably damaging 1.00
S24628:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATAGTACCGGTGCTGGTGC -3'
(R):5'- CCTTGAGTGACTCCTTGTAGC -3'

Sequencing Primer
(F):5'- GGTAGCTGCTGCCCAGG -3'
(R):5'- AGTGACTCCTTGTAGCGGAAG -3'
Posted OnMay 10, 2016