Incidental Mutation 'S24628:Vmn1r22'
ID385656
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000093501
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #S24628 () of strain waterfowl
Quality Score222
Status Not validated
Chromosome6
Chromosomal Location57899959-57901054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57900332 bp
ZygosityHomozygous
Amino Acid Change Threonine to Lysine at position 220 (T220K)
Ref Sequence ENSEMBL: ENSMUSP00000135207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177435]
Predicted Effect probably benign
Transcript: ENSMUST00000177435
AA Change: T220K

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000093501
AA Change: T220K

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1132:Vmn1r22 UTSW 6 57900841 missense probably benign 0.43
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6066:Vmn1r22 UTSW 6 57900879 missense probably benign 0.01
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAGTCTGGTGGCATTTTAGC -3'
(R):5'- AAAACCTGTTCACACTTTCCCATG -3'

Sequencing Primer
(F):5'- GCCACAAGTTTTTCAGCACATTG -3'
(R):5'- TTTCCCATGAACAACATCATCAAGG -3'
Posted OnMay 10, 2016