Incidental Mutation 'S24628:Tbcel'
ID385660
Institutional Source Beutler Lab
Gene Symbol Tbcel
Ensembl Gene ENSMUSG00000037287
Gene Nametubulin folding cofactor E-like
SynonymsE130107N23Rik, Lrrc35
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #S24628 () of strain waterfowl
Quality Score221
Status Not validated
Chromosome9
Chromosomal Location42412316-42507809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42444500 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 139 (C139F)
Ref Sequence ENSEMBL: ENSMUSP00000065125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066148] [ENSMUST00000066179] [ENSMUST00000125995] [ENSMUST00000128959] [ENSMUST00000138506]
Predicted Effect probably benign
Transcript: ENSMUST00000066148
AA Change: C121F

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067882
Gene: ENSMUSG00000037287
AA Change: C121F

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066179
AA Change: C139F

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065125
Gene: ENSMUSG00000037287
AA Change: C139F

DomainStartEndE-ValueType
internal_repeat_1 91 121 9.76e-6 PROSPERO
low complexity region 123 133 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
internal_repeat_1 191 221 9.76e-6 PROSPERO
Pfam:Ubiquitin_2 362 442 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125995
AA Change: C121F

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114721
Gene: ENSMUSG00000037287
AA Change: C121F

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128959
AA Change: C121F

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121164
Gene: ENSMUSG00000037287
AA Change: C121F

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138506
AA Change: C121F

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116616
Gene: ENSMUSG00000037287
AA Change: C121F

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196448
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Tbcel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Tbcel APN 9 42443037 missense probably benign 0.03
IGL01432:Tbcel APN 9 42444521 missense possibly damaging 0.79
IGL02223:Tbcel APN 9 42451718 missense probably benign 0.14
IGL03336:Tbcel APN 9 42439131 missense probably benign 0.17
R0346:Tbcel UTSW 9 42437243 splice site probably benign
R0415:Tbcel UTSW 9 42444500 missense probably benign 0.43
R0849:Tbcel UTSW 9 42437157 missense probably damaging 1.00
R1203:Tbcel UTSW 9 42451651 missense probably damaging 1.00
R1370:Tbcel UTSW 9 42450062 missense probably damaging 1.00
R1617:Tbcel UTSW 9 42461293 intron probably benign
R1995:Tbcel UTSW 9 42451661 missense probably damaging 1.00
R3196:Tbcel UTSW 9 42415952 missense probably damaging 0.99
R3618:Tbcel UTSW 9 42461295 intron probably benign
R4681:Tbcel UTSW 9 42449972 missense probably damaging 1.00
R5008:Tbcel UTSW 9 42416123 missense probably damaging 1.00
R5497:Tbcel UTSW 9 42451745 start codon destroyed possibly damaging 0.59
R5838:Tbcel UTSW 9 42415872 missense probably damaging 0.98
R5976:Tbcel UTSW 9 42439203 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAGTTTCTGAGATCAAAGATGAGC -3'
(R):5'- TGCCTTTGCTAAGTGGTACTCC -3'

Sequencing Primer
(F):5'- CAGAGATTTCTATGCAGAGACGTGC -3'
(R):5'- TGGTACTCCCCGGGGTAAAAG -3'
Posted On2016-05-10