Incidental Mutation 'S24628:Tmprss13'
ID385661
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Nametransmembrane protease, serine 13
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #S24628 () of strain waterfowl
Quality Score199
Status Not validated
Chromosome9
Chromosomal Location45319100-45347581 bp(+) (GRCm38)
Type of Mutationintron (43 bp from exon)
DNA Base Change (assembly) A to G at 45337132 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
Predicted Effect probably null
Transcript: ENSMUST00000034597
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45336105 missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45339404 missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45333674 missense probably benign
IGL02669:Tmprss13 APN 9 45332526 missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45345003 missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45328558 missense unknown
R0233:Tmprss13 UTSW 9 45337100 splice site probably benign
R0271:Tmprss13 UTSW 9 45333688 splice site probably benign
R0415:Tmprss13 UTSW 9 45337132 intron probably null
R0742:Tmprss13 UTSW 9 45332467 missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45328647 missense unknown
R1447:Tmprss13 UTSW 9 45328580 missense unknown
R1493:Tmprss13 UTSW 9 45336107 missense probably benign 0.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45338318 missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45332545 missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45345042 missense probably damaging 0.99
R5666:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45345332 missense probably damaging 1.00
R6343:Tmprss13 UTSW 9 45343200 missense possibly damaging 0.66
R6583:Tmprss13 UTSW 9 45345305 missense probably damaging 1.00
R6671:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45336101 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGGCTTGCTGCTATTGTTAAAG -3'
(R):5'- GAATCAGTAACTCCTGCCCTG -3'

Sequencing Primer
(F):5'- GCTGCTATTGTTAAAGGTGGAAATG -3'
(R):5'- GTCTGTACAGACGCTGATGCAG -3'
Posted On2016-05-10