Incidental Mutation 'S24628:Vmn1r196'
ID385666
Institutional Source Beutler Lab
Gene Symbol Vmn1r196
Ensembl Gene ENSMUSG00000069295
Gene Namevomeronasal 1 receptor 196
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #S24628 () of strain waterfowl
Quality Score222
Status Not validated
Chromosome13
Chromosomal Location22289920-22298360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22293836 bp
ZygosityHomozygous
Amino Acid Change Valine to Aspartic acid at position 215 (V215D)
Ref Sequence ENSEMBL: ENSMUSP00000154145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091735] [ENSMUST00000226245] [ENSMUST00000227516] [ENSMUST00000228382] [ENSMUST00000228557]
Predicted Effect probably damaging
Transcript: ENSMUST00000091735
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089329
Gene: ENSMUSG00000069295
AA Change: V215D

DomainStartEndE-ValueType
Pfam:V1R 35 297 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120610
Predicted Effect probably damaging
Transcript: ENSMUST00000226245
AA Change: V138D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227516
AA Change: V30D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228382
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228557
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Vmn1r196
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Vmn1r196 APN 13 22293699 nonsense probably null
R0415:Vmn1r196 UTSW 13 22293836 missense probably damaging 1.00
R0502:Vmn1r196 UTSW 13 22293387 missense probably benign 0.01
R0503:Vmn1r196 UTSW 13 22293387 missense probably benign 0.01
R2306:Vmn1r196 UTSW 13 22293303 missense probably benign 0.08
R4463:Vmn1r196 UTSW 13 22293683 missense probably benign
R6335:Vmn1r196 UTSW 13 22293717 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACACCTTACAACTGAGGCAG -3'
(R):5'- TCCCTCTGAATCAGCATAAATGGG -3'

Sequencing Primer
(F):5'- CACCTTACAACTGAGGCAGATTAGTG -3'
(R):5'- TGGGCTAAGAACTGCATAACC -3'
Posted On2016-05-10