Incidental Mutation 'S24628:Lcp1'
ID385668
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Namelymphocyte cytosolic protein 1
SynonymsD14Ertd310e, L-fimbrin, Pls2, L-plastin
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75131101-75230842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75227006 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 556 (I556F)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124499
AA Change: I556F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: I556F

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131802
AA Change: I556F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: I556F

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145303
AA Change: I556F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: I556F

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75227093 critical splice donor site probably null
IGL01768:Lcp1 APN 14 75224133 missense probably benign 0.40
IGL01801:Lcp1 APN 14 75199375 missense probably benign 0.10
IGL01940:Lcp1 APN 14 75216365 missense probably benign 0.17
IGL02135:Lcp1 APN 14 75200486 missense probably benign 0.00
IGL02185:Lcp1 APN 14 75229300 missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75224096 missense probably benign 0.04
IGL02604:Lcp1 APN 14 75224126 missense probably benign 0.11
R0244:Lcp1 UTSW 14 75227001 missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75199420 missense probably null 0.59
R0313:Lcp1 UTSW 14 75199433 missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R0811:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R0812:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R1200:Lcp1 UTSW 14 75229302 missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75199444 critical splice donor site probably null
R1915:Lcp1 UTSW 14 75199297 missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75200401 missense probably benign 0.01
R2064:Lcp1 UTSW 14 75198075 critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75206129 missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75215180 missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75215168 missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75200408 missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75200489 missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75208471 nonsense probably null
R5539:Lcp1 UTSW 14 75229298 missense probably benign 0.08
R5561:Lcp1 UTSW 14 75212508 missense probably benign 0.01
R5724:Lcp1 UTSW 14 75226982 missense probably benign 0.18
R5989:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R6731:Lcp1 UTSW 14 75206189 missense probably damaging 1.00
X0027:Lcp1 UTSW 14 75227086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTATTGTGACCCAGCC -3'
(R):5'- GTAATTTGTACAAGGCACAAACACC -3'

Sequencing Primer
(F):5'- ATTGTGACCCAGCCTACCTG -3'
(R):5'- TTGTACAAGGCACAAACACCAGATTC -3'
Posted On2016-05-10