Incidental Mutation 'S24628:Vmn2r116'
ID385673
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23387279 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 388 (M388I)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164856
AA Change: M388I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: M388I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission.
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 unclassified 0.00
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 unclassified 0.00
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site unknown
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTTTTGCCTTTGAACAAC -3'
(R):5'- ACTTGGTTTGGGCATTTATACTCTC -3'

Sequencing Primer
(F):5'- TTGCCTTTGAACAACACCATAG -3'
(R):5'- CATTGTCCTTGGGCAGATTA -3'
Posted OnMay 10, 2016