Incidental Mutation 'S24628:Adgre4'
ID385675
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene
Gene Nameadhesion G protein-coupled receptor E4
SynonymsGpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55749984-55853662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55852288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 658 (V658I)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
Predicted Effect probably benign
Transcript: ENSMUST00000025004
AA Change: V658I

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: V658I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176564
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 unclassified probably benign 0.00
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 unclassified 0.00
IGL01501:Adgre4 APN 17 55802002 unclassified 0.00
IGL01510:Adgre4 APN 17 55818760 unclassified probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 unclassified 0.00
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 unclassified 0.00
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0111:Adgre4 UTSW 17 55817073 missense possibly damaging 0.92
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1330:Adgre4 UTSW 17 55778814 missense probably benign 0.36
R1452:Adgre4 UTSW 17 55784996 missense probably benign 0.35
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site unknown
R4222:Adgre4 UTSW 17 55785121 missense probably damaging 1.00
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6426:Adgre4 UTSW 17 55802196 missense not run
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTAGCCAAGGGATTTATTTGC -3'
(R):5'- CTAGCAATTATAGCTTCATGTGCATGG -3'

Sequencing Primer
(F):5'- TGGACTTGTTTGACCTTTATCAATC -3'
(R):5'- AAGCGTGAGTACCTGAGT -3'
Posted OnMay 10, 2016