Incidental Mutation 'R4983:Kmt2c'
ID385715
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Namelysine (K)-specific methyltransferase 2C
SynonymsMll3, E330008K23Rik, HALR
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25271798-25498783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25295511 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 436 (R436W)
Ref Sequence ENSEMBL: ENSMUSP00000133482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000174734]
Predicted Effect probably benign
Transcript: ENSMUST00000045291
AA Change: R3847W

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: R3847W

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172556
SMART Domains Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
SCOP:d2spca_ 84 177 1e-3 SMART
low complexity region 196 209 N/A INTRINSIC
coiled coil region 307 345 N/A INTRINSIC
low complexity region 379 405 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 568 586 N/A INTRINSIC
low complexity region 688 702 N/A INTRINSIC
low complexity region 735 752 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
low complexity region 863 886 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1260 1267 N/A INTRINSIC
PHD 1302 1348 2.94e-2 SMART
FYRN 1402 1445 1.18e-21 SMART
FYRC 1451 1538 4.54e-32 SMART
SET 1608 1730 3.17e-34 SMART
PostSET 1732 1748 1.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173673
Predicted Effect possibly damaging
Transcript: ENSMUST00000174734
AA Change: R436W

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133482
Gene: ENSMUSG00000038056
AA Change: R436W

DomainStartEndE-ValueType
low complexity region 49 75 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 411 416 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
low complexity region 1032 1039 N/A INTRINSIC
PHD 1074 1120 2.94e-2 SMART
FYRN 1174 1217 1.18e-21 SMART
FYRC 1223 1310 4.54e-32 SMART
SET 1384 1506 3.17e-34 SMART
PostSET 1508 1524 1.82e-6 SMART
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0671:Kmt2c UTSW 5 25404365 missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25285079 missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25352280 missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTAGGATTGAAAAGGCAACAC -3'
(R):5'- CCCCTTTAAATTGGGATGCCATG -3'

Sequencing Primer
(F):5'- CAACACTTGCTCTCTCCCC -3'
(R):5'- AGTCACAAGTTGGAGCTGGTC -3'
Posted On2016-05-10