Incidental Mutation 'R4984:Cpb1'
ID385780
Institutional Source Beutler Lab
Gene Symbol Cpb1
Ensembl Gene ENSMUSG00000011463
Gene Namecarboxypeptidase B1 (tissue)
Synonyms1810063F02Rik, 0910001A18Rik, 2210008M23Rik
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4984 (G1)
Quality Score217
Status Validated
Chromosome3
Chromosomal Location20248264-20275733 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTTT to GTT at 20270352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011607]
Predicted Effect probably null
Transcript: ENSMUST00000011607
SMART Domains Protein: ENSMUSP00000011607
Gene: ENSMUSG00000011463

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Propep_M14 26 102 2.4e-19 PFAM
Zn_pept 117 398 2.08e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137855
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Cpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Cpb1 APN 3 20252029 missense probably benign 0.00
IGL01061:Cpb1 APN 3 20266516 missense probably benign 0.06
IGL01376:Cpb1 APN 3 20270324 missense probably benign 0.00
IGL01409:Cpb1 APN 3 20249805 missense possibly damaging 0.51
IGL01505:Cpb1 APN 3 20266246 missense probably damaging 1.00
IGL01599:Cpb1 APN 3 20251954 critical splice donor site probably null
IGL01672:Cpb1 APN 3 20275421 missense probably null 0.34
IGL02421:Cpb1 APN 3 20251984 missense probably damaging 1.00
IGL02685:Cpb1 APN 3 20265356 missense probably damaging 1.00
IGL02825:Cpb1 APN 3 20249725 missense probably damaging 1.00
IGL02929:Cpb1 APN 3 20275466 missense probably benign 0.00
IGL03229:Cpb1 APN 3 20249837 nonsense probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0485:Cpb1 UTSW 3 20275628 missense unknown
R0609:Cpb1 UTSW 3 20262474 missense probably damaging 1.00
R0622:Cpb1 UTSW 3 20249818 missense probably damaging 1.00
R0676:Cpb1 UTSW 3 20266533 splice site probably null
R0829:Cpb1 UTSW 3 20251943 splice site probably benign
R0981:Cpb1 UTSW 3 20275490 missense probably benign 0.29
R1496:Cpb1 UTSW 3 20263532 missense probably damaging 0.99
R1535:Cpb1 UTSW 3 20266287 missense probably benign 0.19
R1607:Cpb1 UTSW 3 20263782 missense probably benign 0.03
R1707:Cpb1 UTSW 3 20275491 missense probably damaging 0.99
R1753:Cpb1 UTSW 3 20266241 missense possibly damaging 0.67
R1866:Cpb1 UTSW 3 20263756 missense probably benign 0.00
R2177:Cpb1 UTSW 3 20266447 missense probably benign 0.41
R2234:Cpb1 UTSW 3 20275465 missense probably benign 0.04
R3110:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R3112:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R4353:Cpb1 UTSW 3 20262544 missense probably benign 0.07
R4405:Cpb1 UTSW 3 20263569 missense probably benign 0.00
R4485:Cpb1 UTSW 3 20249701 missense probably benign 0.00
R4734:Cpb1 UTSW 3 20263712 missense probably benign 0.43
R5807:Cpb1 UTSW 3 20263742 missense probably damaging 0.98
R6377:Cpb1 UTSW 3 20275584 critical splice donor site probably null
R6441:Cpb1 UTSW 3 20249814 missense probably damaging 1.00
R7175:Cpb1 UTSW 3 20263763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCCAACTCTGCTGTTACC -3'
(R):5'- GGACATCTAACTGGTTGGTCC -3'

Sequencing Primer
(F):5'- CTGTTACCTTTTGTGTGGGAAAAAC -3'
(R):5'- CTGGTTGGTCCTTATTAATTCAAAGG -3'
Posted On2016-05-10