Incidental Mutation 'R4984:Cdc42bpg'
ID385807
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6316223 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 812 (I812N)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025681
AA Change: I812N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: I812N

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGAGACAGTTCTGTCCCTCC -3'
(R):5'- CTCTGCAGAAAATGAATGAGCG -3'

Sequencing Primer
(F):5'- CCACACCGGACCTGTCTGTC -3'
(R):5'- TGTGGAGTCTCACCCCCATG -3'
Posted On2016-05-10