Incidental Mutation 'R4984:Adra2a'
ID385808
Institutional Source Beutler Lab
Gene Symbol Adra2a
Ensembl Gene ENSMUSG00000033717
Gene Nameadrenergic receptor, alpha 2a
Synonymsalpha2A-AR, Adra-2a, Adra-2, alpha2A, alpha2A-adrenergic receptor, alpha(2A)AR
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location54045182-54048982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54046639 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 142 (I142T)
Ref Sequence ENSEMBL: ENSMUSP00000036203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036700]
Predicted Effect probably damaging
Transcript: ENSMUST00000036700
AA Change: I142T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: I142T

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Meta Mutation Damage Score 0.49 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Adra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda UTSW 19 54046495 missense probably damaging 1.00
splenda2 UTSW 19 54046639 missense probably damaging 1.00
R0245:Adra2a UTSW 19 54047409 missense probably damaging 1.00
R1933:Adra2a UTSW 19 54046406 missense probably damaging 1.00
R2175:Adra2a UTSW 19 54046362 missense probably benign 0.04
R4553:Adra2a UTSW 19 54046735 missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54046495 missense probably damaging 1.00
R5260:Adra2a UTSW 19 54046608 missense probably damaging 1.00
R5326:Adra2a UTSW 19 54046681 missense probably damaging 1.00
R5585:Adra2a UTSW 19 54046239 missense probably benign 0.00
R6861:Adra2a UTSW 19 54046387 missense probably damaging 1.00
R7290:Adra2a UTSW 19 54046404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCGCGGTGTTCACCAGTC -3'
(R):5'- TGATCTTGCAGCTTGGCTCG -3'

Sequencing Primer
(F):5'- TCGCGCGCTCAAAGCTC -3'
(R):5'- CCACACGGTGACAATGA -3'
Posted On2016-05-10