Incidental Mutation 'R4985:Adgb'
ID385835
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 042579-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4985 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10400632 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 331 (R331G)
Ref Sequence ENSEMBL: ENSMUSP00000045452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045328
AA Change: R331G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994
AA Change: R331G

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
AA Change: R729G

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: R729G

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172530
AA Change: R729G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: R729G

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179956
AA Change: R731G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: R731G

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208717
AA Change: R705G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 probably benign Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Arntl T C 7: 113,285,073 V106A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Cdkn2aip G T 8: 47,713,445 probably benign Het
Ces1d T C 8: 93,175,144 E399G possibly damaging Het
Col9a3 G A 2: 180,603,400 R134H unknown Het
Ddb2 T C 2: 91,212,298 probably null Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R295H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I838V probably benign Het
Gfod2 C T 8: 105,728,011 R79Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Gm29106 A T 1: 118,199,220 D214V probably benign Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Krt86 A T 15: 101,477,265 E347V probably damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K221I probably damaging Het
Lmntd2 A C 7: 141,213,277 S127R probably benign Het
Lrba A G 3: 86,327,436 probably null Het
Mettl26 T A 17: 25,876,776 *202R probably null Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Nap1l1 T C 10: 111,490,083 C88R probably benign Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Olfr913 T A 9: 38,594,362 I47N possibly damaging Het
Pafah1b1 T G 11: 74,685,988 D159A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T293A probably benign Het
Pidd1 A C 7: 141,438,591 *916E probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D164V unknown Het
Rnf8 T C 17: 29,626,860 S199P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tgif1 T C 17: 70,844,872 Y248C probably benign Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCCTGGATGTGCAACAAAGATC -3'
(R):5'- GGTATTACTGGACAGAAAGCAATGC -3'

Sequencing Primer
(F):5'- TGGATGTGCAACAAAGATCCTTCC -3'
(R):5'- GCAAGTGAAGGCCAGTTATTCTTCC -3'
Posted On2016-05-10