Incidental Mutation 'R4985:0610011F06Rik'
List |< first << previous [record 48 of 386652] next >> last >|
ID385854
Institutional Source Beutler Lab
Gene Symbol 0610011F06Rik
Ensembl Gene ENSMUSG00000025731
Gene NameRIKEN cDNA 0610011F06 gene
Synonyms
Accession Numbers
Stock #R4985 (G1)
Quality Score103
Status Validated
Chromosome17
Chromosomal Location25875464-25886007 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 25876776 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 202 (*202R)
Ref Sequence ENSEMBL: ENSMUSP00000126198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169308]
Predicted Effect probably null
Transcript: ENSMUST00000169308
AA Change: *202R
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731
AA Change: *202R

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 I20N unknown Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Adgb T C 10: 10,400,632 R729G possibly damaging Het
Arntl T C 7: 113,285,073 V99A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Ces1d T C 8: 93,175,144 E49G possibly damaging Het
Col9a3 G A 2: 180,603,400 R132H noncoding transcript Het
Ddb2 T C 2: 91,212,298 T406A possibly damaging Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T238N probably damaging Het
E030037K01Rik G T 8: 47,713,445 A60S unknown Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R294H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I664V probably benign Het
Gfod2 C T 8: 105,728,011 R155Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Impdh2 T C 9: 108,565,210 S3P noncoding transcript Het
Krt86 A T 15: 101,477,265 E347V probably damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K153* probably null Het
Lmntd2 A C 7: 141,213,277 S117R probably benign Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Nap1l1 T C 10: 111,490,083 C88R probably benign Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Olfr913 T A 9: 38,594,362 I47N possibly damaging Het
Pafah1b1 T G 11: 74,685,988 D325A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T84A probably benign Het
Pidd1 A C 7: 141,438,591 L1078R probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D154V noncoding transcript Het
Rnf8 T C 17: 29,626,860 S142P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tgif1 T C 17: 70,844,872 Y195C probably benign Het
Thsd1 C T 8: 22,243,415 R163C noncoding transcript Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D799G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in 0610011F06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:0610011F06Rik APN 17 25876124 critical splice donor site probably null 0.00
R5813:0610011F06Rik UTSW 17 25876021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGGTAGCTTGGCTCAGAG -3'
(R):5'- ATCAGGCACTTGTTGTTGGC -3'

Sequencing Primer
(F):5'- TAGCTTGGCTCAGAGAGAGG -3'
(R):5'- TCCCAAGTGCTGGGATTA -3'
Posted OnMay 10, 2016