Incidental Mutation 'R4986:Kbtbd6'
ID385889
Institutional Source Beutler Lab
Gene Symbol Kbtbd6
Ensembl Gene ENSMUSG00000075502
Gene Namekelch repeat and BTB (POZ) domain containing 6
SynonymsGm5465
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4986 (G1)
Quality Score175
Status Validated
Chromosome14
Chromosomal Location79451835-79454818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79452609 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 248 (H248R)
Ref Sequence ENSEMBL: ENSMUSP00000097929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100359] [ENSMUST00000226192]
Predicted Effect probably damaging
Transcript: ENSMUST00000100359
AA Change: H248R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097929
Gene: ENSMUSG00000075502
AA Change: H248R

DomainStartEndE-ValueType
low complexity region 51 60 N/A INTRINSIC
Blast:BTB 74 107 3e-11 BLAST
BTB 126 231 1.05e-23 SMART
BACK 236 342 7.58e-20 SMART
low complexity region 380 395 N/A INTRINSIC
SCOP:d1k3ia3 475 541 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201579
AA Change: H248R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144571
Gene: ENSMUSG00000106782
AA Change: H248R

DomainStartEndE-ValueType
low complexity region 51 60 N/A INTRINSIC
Blast:BTB 74 107 3e-11 BLAST
BTB 126 231 1.05e-23 SMART
BACK 236 342 7.58e-20 SMART
low complexity region 380 395 N/A INTRINSIC
SCOP:d1k3ia3 475 541 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226192
AA Change: H185R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Kbtbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Kbtbd6 APN 14 79453248 missense probably damaging 0.97
IGL01348:Kbtbd6 APN 14 79453343 missense probably damaging 0.99
IGL01735:Kbtbd6 APN 14 79453449 missense probably damaging 0.96
IGL02441:Kbtbd6 APN 14 79453319 missense probably benign
R0145:Kbtbd6 UTSW 14 79453024 missense probably benign 0.06
R0316:Kbtbd6 UTSW 14 79453024 missense probably benign 0.06
R0731:Kbtbd6 UTSW 14 79451884 nonsense probably null
R1776:Kbtbd6 UTSW 14 79452605 missense probably benign 0.23
R4705:Kbtbd6 UTSW 14 79452606 missense probably benign 0.01
R4749:Kbtbd6 UTSW 14 79453287 missense possibly damaging 0.95
R4772:Kbtbd6 UTSW 14 79452156 missense probably damaging 0.99
R6107:Kbtbd6 UTSW 14 79453113 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTACTGCTACACTGGTCG -3'
(R):5'- CTTAAAGACTTCCCCAGCACTG -3'

Sequencing Primer
(F):5'- TGCTACACTGGTCGCGTGTC -3'
(R):5'- CTCTTTGGGAGCAGCCTC -3'
Posted On2016-05-10