Incidental Mutation 'R4987:Wdsub1'
ID385899
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4987 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 59870393 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751] [ENSMUST00000133809]
Predicted Effect probably benign
Transcript: ENSMUST00000028368
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102751
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133809
AA Change: V166A
SMART Domains Protein: ENSMUSP00000114814
Gene: ENSMUSG00000026988
AA Change: V166A

DomainStartEndE-ValueType
WD40 7 46 1.5e-3 SMART
WD40 48 96 2.48e-4 SMART
WD40 106 145 6e-3 SMART
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Fmo5 T C 3: 97,635,578 M68T probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krt83 A G 15: 101,487,009 I402T probably benign Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Ppme1 T C 7: 100,345,071 D145G probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Serinc2 C T 4: 130,263,027 probably null Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Smco2 A G 6: 146,856,092 D48G possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
R7041:Wdsub1 UTSW 2 59852880 missense probably damaging 1.00
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCTGAGAACCTAGGGG -3'
(R):5'- AGAAAATTCATCCGTTTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTTGAGAGGC -3'
(R):5'- ATCCGTTTGCCTCTGTTTGTAATAC -3'
Posted On2016-05-10