Incidental Mutation 'R0423:Mcm3ap'
ID38594
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 038625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0423 (G1)
Quality Score175
Status Validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76502705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1389 (G1389D)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
Predicted Effect probably benign
Transcript: ENSMUST00000170795
AA Change: G1389D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: G1389D

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219811
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
A630001G21Rik A G 1: 85,726,466 I50T probably benign Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gfra2 C T 14: 70,896,081 T117M probably damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Ppip5k2 A G 1: 97,761,427 S38P possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spag6 A G 2: 18,710,593 D61G probably benign Het
Spen T A 4: 141,479,336 N660I unknown Het
Sptan1 T G 2: 30,028,672 C2246G probably null Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
psychopomp UTSW 10 76501100 missense probably damaging 0.97
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCAGGGATGGTTTCTATTGCTCG -3'
(R):5'- CCACGACAGAGGGCAAGTACATTG -3'

Sequencing Primer
(F):5'- TGAGCCAATTTCACAACTGTC -3'
(R):5'- CTTACACCAAGTAGATGGCTGTG -3'
Posted On2013-05-23