Incidental Mutation 'R4988:1110001J03Rik'
List |< first << previous [record 82 of 386652] next >> last >|
ID385948
Institutional Source Beutler Lab
Gene Symbol 1110001J03Rik
Ensembl Gene ENSMUSG00000019689
Gene NameRIKEN cDNA 1110001J03 gene
SynonymsFmc1
MMRRC Submission 042582-MU
Accession Numbers
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38533502-38539449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38534982 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 37 (Y37F)
Ref Sequence ENSEMBL: ENSMUSP00000019833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019833]
Predicted Effect probably benign
Transcript: ENSMUST00000019833
AA Change: Y37F

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008F21Rik T A 8: 129,145,532 M239K possibly damaging Het
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
AC107766.1 A T 1: 34,723,454 H597L unknown Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2184T probably damaging Het
Amy2b T C 3: 113,151,234 I327V noncoding transcript Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
BC027231 A G 16: 44,734,542 E327G possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 D35V probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 Y186* noncoding transcript Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 R108* noncoding transcript Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mta1 T C 12: 113,130,978 V396A noncoding transcript Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M303K noncoding transcript Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav16 A T 14: 53,738,357 H19L noncoding transcript Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in 1110001J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03091:1110001J03Rik APN 6 38539235 missense probably damaging 1.00
R3887:1110001J03Rik UTSW 6 38539288 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCTTACGGCAGTCCAAAGG -3'
(R):5'- CAGTAGGGGATTTCAGACCG -3'

Sequencing Primer
(F):5'- AGAGGATTCGGCACCTTCC -3'
(R):5'- AGACACGTTTGTCCTGAG -3'
Posted OnMay 10, 2016