Incidental Mutation 'R4988:Cdc27'
ID385965
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104526124 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 334 (S334P)
Ref Sequence ENSEMBL: ENSMUSP00000091452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106961] [ENSMUST00000106962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093923
AA Change: S334P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687
AA Change: S334P

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106961
AA Change: S340P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102574
Gene: ENSMUSG00000020687
AA Change: S340P

DomainStartEndE-ValueType
Pfam:Apc3 17 95 1.9e-23 PFAM
Pfam:TPR_2 115 148 9.2e-5 PFAM
Pfam:TPR_1 116 148 9.1e-5 PFAM
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106962
AA Change: S340P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687
AA Change: S340P

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0426:Cdc27 UTSW 11 104513027 splice site probably null
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3405:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4037:Cdc27 UTSW 11 104507207 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4451:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4452:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
R7237:Cdc27 UTSW 11 104517419 missense probably benign
R7315:Cdc27 UTSW 11 104515444 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCTATGTGTACTTGCTCTGAAGG -3'
(R):5'- TTATCGTTTAGGAAGGGAGCAG -3'

Sequencing Primer
(F):5'- GCTCTGAAGGTTAAGTGTCTATGAAC -3'
(R):5'- AGCAGGCGGACTCTTTTTAATC -3'
Posted On2016-05-10