Incidental Mutation 'R4988:Slc6a19'
ID385970
Institutional Source Beutler Lab
Gene Symbol Slc6a19
Ensembl Gene ENSMUSG00000021565
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 19
SynonymsB<0>AT1, 4632401C08Rik
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73679745-73704865 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 73685840 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 366 (W366*)
Ref Sequence ENSEMBL: ENSMUSP00000022048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000124406]
Predicted Effect probably null
Transcript: ENSMUST00000022048
AA Change: W366*
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565
AA Change: W366*

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123997
Predicted Effect probably benign
Transcript: ENSMUST00000124406
SMART Domains Protein: ENSMUSP00000119313
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 79 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140878
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene result in Hartnup disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and impaired amino acid absorption and excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Slc6a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Slc6a19 APN 13 73700590 missense probably damaging 1.00
IGL02425:Slc6a19 APN 13 73691800 missense probably benign 0.00
IGL03030:Slc6a19 APN 13 73700471 missense probably damaging 1.00
IGL03067:Slc6a19 APN 13 73689730 nonsense probably null
IGL03216:Slc6a19 APN 13 73686181 missense probably benign
IGL03330:Slc6a19 APN 13 73689560 missense possibly damaging 0.95
H8562:Slc6a19 UTSW 13 73700124 intron probably benign
R0107:Slc6a19 UTSW 13 73684057 missense possibly damaging 0.93
R0446:Slc6a19 UTSW 13 73691695 missense probably benign 0.01
R1422:Slc6a19 UTSW 13 73685869 missense probably benign 0.05
R1443:Slc6a19 UTSW 13 73684344 missense probably damaging 1.00
R1501:Slc6a19 UTSW 13 73684048 missense probably benign 0.08
R1564:Slc6a19 UTSW 13 73686124 missense probably damaging 1.00
R1632:Slc6a19 UTSW 13 73689908 splice site probably null
R1832:Slc6a19 UTSW 13 73692950 missense probably benign
R2077:Slc6a19 UTSW 13 73700566 missense probably benign
R4418:Slc6a19 UTSW 13 73684395 missense possibly damaging 0.93
R4486:Slc6a19 UTSW 13 73681717 missense probably damaging 0.98
R4510:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4511:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4803:Slc6a19 UTSW 13 73684042 missense possibly damaging 0.91
R4965:Slc6a19 UTSW 13 73700558 missense probably benign 0.00
R5085:Slc6a19 UTSW 13 73691753 missense probably benign 0.11
R5533:Slc6a19 UTSW 13 73685829 missense possibly damaging 0.67
R5851:Slc6a19 UTSW 13 73691740 missense possibly damaging 0.55
R5874:Slc6a19 UTSW 13 73684368 missense probably damaging 0.98
R6074:Slc6a19 UTSW 13 73689763 missense probably benign 0.00
R6608:Slc6a19 UTSW 13 73683972 missense probably damaging 1.00
R7275:Slc6a19 UTSW 13 73686078 missense probably benign 0.11
R7386:Slc6a19 UTSW 13 73689891 missense possibly damaging 0.91
R7388:Slc6a19 UTSW 13 73693084 missense probably benign 0.30
R7393:Slc6a19 UTSW 13 73692974 missense probably benign 0.00
Z1088:Slc6a19 UTSW 13 73689730 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAGGGTAAGATGCTGACTGTAC -3'
(R):5'- AGTTGCCACCCTAGCGTTTG -3'

Sequencing Primer
(F):5'- GCTGACTGTACAAAGACTCTCTG -3'
(R):5'- TGTTCAGAGGGCATCCACATAGAC -3'
Posted On2016-05-10