Incidental Mutation 'R4989:Wdsub1'
ID385992
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission 042583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4989 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 59870414 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751] [ENSMUST00000133809]
Predicted Effect probably benign
Transcript: ENSMUST00000028368
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102751
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133809
AA Change: I159K
SMART Domains Protein: ENSMUSP00000114814
Gene: ENSMUSG00000026988
AA Change: I159K

DomainStartEndE-ValueType
WD40 7 46 1.5e-3 SMART
WD40 48 96 2.48e-4 SMART
WD40 106 145 6e-3 SMART
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (115/115)
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931406P16Rik A C 7: 34,245,800 Y552D probably damaging Het
Acot6 A G 12: 84,109,015 K246E probably benign Het
Actl11 T A 9: 107,931,416 H979Q probably damaging Het
Adal T A 2: 121,155,549 probably benign Het
Add2 G A 6: 86,110,858 V596I probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Akap2 T A 4: 57,856,552 V668E probably benign Het
Ank1 T C 8: 23,141,118 probably benign Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Ankib1 T C 5: 3,713,217 Y504C probably damaging Het
Ankrd29 T C 18: 12,262,185 K217R probably damaging Het
Ankrd45 T C 1: 161,155,306 V129A probably damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arhgef26 G A 3: 62,340,385 D297N possibly damaging Het
Atxn7l3b C A 10: 112,928,744 probably benign Het
Auh A G 13: 52,841,029 S167P probably damaging Het
Bach1 A T 16: 87,719,000 K143I possibly damaging Het
Bbx T A 16: 50,224,738 T487S probably damaging Het
Bche T G 3: 73,701,844 D83A probably benign Het
Bri3bp G T 5: 125,441,696 probably benign Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cdc42bpa A G 1: 180,137,801 T1028A probably damaging Het
Celsr2 T C 3: 108,412,629 I956V possibly damaging Het
Cep95 A T 11: 106,816,654 probably null Het
Cic G T 7: 25,287,110 G1289C probably damaging Het
Cndp1 A G 18: 84,631,900 Y223H probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Ctsm A G 13: 61,538,962 Y39H probably damaging Het
Dhrs2 T C 14: 55,237,265 V119A probably damaging Het
Drosha T A 15: 12,935,007 M1336K probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Erich3 C T 3: 154,748,388 T597I possibly damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fcgrt C T 7: 45,101,948 G192D probably benign Het
Fras1 A G 5: 96,650,682 E1184G possibly damaging Het
Gm5155 A G 7: 17,905,218 probably null Het
Gm8989 A T 7: 106,329,457 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hadh A T 3: 131,235,548 L274* probably null Het
Hus1 T C 11: 9,006,027 S169G probably damaging Het
Hydin A T 8: 110,563,922 I3338F possibly damaging Het
Ighv11-1 T G 12: 113,982,148 E28D probably benign Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Krit1 A T 5: 3,822,238 N421I probably damaging Het
Lamb1 A G 12: 31,326,678 D1619G probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrrc37a G C 11: 103,456,739 F3043L unknown Het
Lrrc46 A T 11: 97,040,939 V19D probably damaging Het
Mapkap1 G T 2: 34,581,291 S197I probably damaging Het
Mrps35 A C 6: 147,060,147 K173N possibly damaging Het
Mtf2 A G 5: 108,073,028 probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Ncf1 A C 5: 134,223,413 D261E probably damaging Het
Notch1 C T 2: 26,481,181 E298K probably damaging Het
Nrxn1 A T 17: 90,620,846 probably benign Het
Olfr110 G T 17: 37,499,126 L158F probably benign Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr195 T C 16: 59,149,618 L256P probably damaging Het
Olfr46 C A 7: 140,610,391 A75E possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Papolg T C 11: 23,873,919 probably null Het
Pgk2 A G 17: 40,207,511 V342A probably damaging Het
Phf2 G A 13: 48,807,844 A790V unknown Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Prl3d3 T C 13: 27,159,089 I86T possibly damaging Het
Prss8 G T 7: 127,926,463 Q295K probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrfpr A G 3: 36,222,136 V35A probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rpl41 G T 10: 128,548,783 probably null Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Serpini1 T A 3: 75,614,488 N95K probably benign Het
Sfxn1 A T 13: 54,088,914 T64S probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc25a4 T A 8: 46,207,472 K296N probably benign Het
Slc37a1 A G 17: 31,322,146 N204S probably damaging Het
Slc9c1 A G 16: 45,593,437 N976S probably benign Het
Smarcal1 T C 1: 72,632,860 S847P possibly damaging Het
Smg1 A T 7: 118,158,100 probably benign Het
Smg1 C T 7: 118,208,051 A168T probably benign Het
Sptlc1 A G 13: 53,351,656 I242T probably damaging Het
St8sia2 T C 7: 73,966,961 I89V possibly damaging Het
Supt20 A T 3: 54,695,134 probably benign Het
Tep1 T C 14: 50,839,000 D1659G probably benign Het
Tex10 C A 4: 48,458,525 probably benign Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmbim6 C A 15: 99,402,069 S22* probably null Het
Tmc2 A T 2: 130,202,041 K65M possibly damaging Het
Tmod1 A G 4: 46,090,872 S142G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt6 T C 2: 132,808,271 R349G possibly damaging Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ttn C T 2: 76,774,778 V16555I probably benign Het
Ubr3 T C 2: 70,020,446 probably benign Het
Vmn1r17 A C 6: 57,360,475 F253V possibly damaging Het
Vmn1r201 G T 13: 22,475,452 A279S possibly damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vwa5a A G 9: 38,722,630 E43G probably benign Het
Wdr86 C T 5: 24,712,845 probably null Het
Zcchc11 T A 4: 108,526,845 probably benign Het
Zcchc7 T C 4: 44,931,039 L76P probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp263 T C 16: 3,749,128 C148R probably damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCTGAGAACCTAGGGG -3'
(R):5'- AGAAAATTCATCCGTTTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTTGAGAGGC -3'
(R):5'- ATCCGTTTGCCTCTGTTTGTAATAC -3'
Posted On2016-05-10