Incidental Mutation 'R4990:Ror1'
ID386115
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100441964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 845 (I845V)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: I845V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: I845V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense not run
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAATTACATGTTCCCGAGCC -3'
(R):5'- CAAGCAAAGACGATTGTTTTGAGTC -3'

Sequencing Primer
(F):5'- CGAGCCAAGGGATTACACC -3'
(R):5'- TTGTTGCCAAAAACAGTGATACCC -3'
Posted On2016-05-10