Incidental Mutation 'R4990:Megf6'
ID386118
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154267226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1132 (E1132G)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030897
AA Change: E1132G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: E1132G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect probably benign
Transcript: ENSMUST00000128700
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142110
Predicted Effect probably benign
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTAGACCCAGCCTAGAGAACC -3'
(R):5'- AGGTAAGCTTTCTGGGAACG -3'

Sequencing Primer
(F):5'- GCCACTGATGCTGAGAAGC -3'
(R):5'- TCTGGGAACGGAGCAGTG -3'
Posted On2016-05-10