Incidental Mutation 'R4990:Fbxw18'
ID386138
Institutional Source Beutler Lab
Gene Symbol Fbxw18
Ensembl Gene ENSMUSG00000074059
Gene NameF-box and WD-40 domain protein 18
Synonyms
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109676734-109702700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109688393 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 414 (E414G)
Ref Sequence ENSEMBL: ENSMUSP00000095962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098359]
Predicted Effect probably damaging
Transcript: ENSMUST00000098359
AA Change: E414G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095962
Gene: ENSMUSG00000074059
AA Change: E414G

DomainStartEndE-ValueType
FBOX 8 48 4.13e-6 SMART
Blast:WD40 140 179 2e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Fbxw18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fbxw18 APN 9 109693343 missense probably benign 0.00
IGL00820:Fbxw18 APN 9 109693369 missense probably damaging 1.00
IGL01447:Fbxw18 APN 9 109701607 missense probably damaging 1.00
IGL01511:Fbxw18 APN 9 109688821 missense possibly damaging 0.83
IGL01956:Fbxw18 APN 9 109693357 missense probably damaging 0.98
IGL02089:Fbxw18 APN 9 109701322 missense probably benign 0.00
PIT4810001:Fbxw18 UTSW 9 109676890 nonsense probably null
R0004:Fbxw18 UTSW 9 109701313 missense probably damaging 0.96
R0124:Fbxw18 UTSW 9 109691515 missense probably benign 0.00
R0375:Fbxw18 UTSW 9 109688839 missense possibly damaging 0.63
R1652:Fbxw18 UTSW 9 109690627 missense probably benign 0.35
R2153:Fbxw18 UTSW 9 109693370 missense probably damaging 1.00
R2294:Fbxw18 UTSW 9 109676797 missense probably damaging 1.00
R3738:Fbxw18 UTSW 9 109688913 missense possibly damaging 0.57
R4706:Fbxw18 UTSW 9 109690517 missense probably benign 0.00
R4982:Fbxw18 UTSW 9 109702651 start gained probably benign
R5314:Fbxw18 UTSW 9 109693178 missense possibly damaging 0.90
R5520:Fbxw18 UTSW 9 109691521 missense probably benign 0.00
R5634:Fbxw18 UTSW 9 109676803 missense possibly damaging 0.49
R5718:Fbxw18 UTSW 9 109691568 missense probably benign 0.01
R5894:Fbxw18 UTSW 9 109700167 missense possibly damaging 0.83
R5928:Fbxw18 UTSW 9 109700081 missense probably damaging 0.99
R6175:Fbxw18 UTSW 9 109676879 missense probably damaging 1.00
R6696:Fbxw18 UTSW 9 109688764 missense probably benign 0.09
R6944:Fbxw18 UTSW 9 109702587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCAATGCATTGATGTGAGGG -3'
(R):5'- AGATCTTGAGACTATGGGTGGTAC -3'

Sequencing Primer
(F):5'- TCAGTCAGATGCCCTGGAACTG -3'
(R):5'- TGGAGCACTTTCAGAGTCCAG -3'
Posted On2016-05-10