Incidental Mutation 'R4991:Kif1a'
ID386172
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission 042585-MU
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93078808 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 46 (T46A)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000186861] [ENSMUST00000190723]
Predicted Effect probably benign
Transcript: ENSMUST00000086819
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112958
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171556
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171796
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186861
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141194
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 109 9.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect probably benign
Transcript: ENSMUST00000190723
AA Change: T46A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: T46A

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
osmium UTSW 1 93058810 splice site probably benign
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 unclassified probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACAGCTGTGCACATAAGG -3'
(R):5'- TGACTGCAAGTGGGTCTCTG -3'

Sequencing Primer
(F):5'- TTGGTGATCAACTCAGAGTGACCC -3'
(R):5'- AAGTGGGTCTCTGGTCCC -3'
Posted On2016-05-10