Incidental Mutation 'R4991:Olfr313'
ID386206
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58817718 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 237 (S237P)
Ref Sequence ENSEMBL: ENSMUSP00000150529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220] [ENSMUST00000217506]
Predicted Effect probably damaging
Transcript: ENSMUST00000082220
AA Change: S237P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: S237P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217506
AA Change: S237P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
LCD18:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0269:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R2917:Olfr313 UTSW 11 58817488 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4245:Olfr313 UTSW 11 58817778 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACATCCCTCCAGTCATGAG -3'
(R):5'- CACTGTAGTCTTCAAGGTCTCAG -3'

Sequencing Primer
(F):5'- ATGAGACTGTCCTGCACTGAC -3'
(R):5'- CTCCCACAATAAAGTTTCTGTAGAGC -3'
Posted On2016-05-10