Incidental Mutation 'R4991:Spata31d1a'
ID386214
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59703151 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 388 (N388D)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably benign
Transcript: ENSMUST00000066510
AA Change: N388D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: N388D

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably benign
Transcript: ENSMUST00000224982
AA Change: N388D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGAAATAGTCCCTTCCTGG -3'
(R):5'- ACAAAGGCCTATGCTGTGGAG -3'

Sequencing Primer
(F):5'- GAAGAGCTGGATGTCCTT -3'
(R):5'- GGGGATCATTTGTCTCCCAGC -3'
Posted On2016-05-10