Incidental Mutation 'R4992:Glmn'
ID386246
Institutional Source Beutler Lab
Gene Symbol Glmn
Ensembl Gene ENSMUSG00000029276
Gene Nameglomulin, FKBP associated protein
Synonyms9330160J16Rik, Fap48, Fap68
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107548967-107597888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107557301 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 483 (D483A)
Ref Sequence ENSEMBL: ENSMUSP00000080766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546]
Predicted Effect probably damaging
Transcript: ENSMUST00000078021
AA Change: D483A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276
AA Change: D483A

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082121
AA Change: D483A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276
AA Change: D483A

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100949
AA Change: D419A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276
AA Change: D419A

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Multiple splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete embryonic lethality during organogenesis associated with growth retardation, delayed neural tube closure, incomplete embryo turning, pericardial effusion, disorganized yolk sac vascular plexus and head mesenchyme hypocellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Glmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Glmn APN 5 107570139 missense possibly damaging 0.79
IGL00925:Glmn APN 5 107557327 missense probably damaging 1.00
IGL01092:Glmn APN 5 107578512 critical splice acceptor site probably null
IGL02503:Glmn APN 5 107562778 missense probably damaging 0.98
IGL02725:Glmn APN 5 107575289 missense possibly damaging 0.95
IGL03116:Glmn APN 5 107551083 missense probably damaging 1.00
mauna_kea UTSW 5 107593880 critical splice acceptor site probably null
R0078:Glmn UTSW 5 107557970 missense probably benign 0.31
R0115:Glmn UTSW 5 107560934 missense probably benign 0.00
R0481:Glmn UTSW 5 107560934 missense probably benign 0.00
R1895:Glmn UTSW 5 107570244 missense probably benign 0.34
R1954:Glmn UTSW 5 107572377 missense probably damaging 1.00
R2090:Glmn UTSW 5 107561928 missense probably damaging 1.00
R2132:Glmn UTSW 5 107578455 missense probably damaging 0.98
R3962:Glmn UTSW 5 107561045 intron probably benign
R4296:Glmn UTSW 5 107558502 missense possibly damaging 0.52
R4591:Glmn UTSW 5 107561051 critical splice donor site probably null
R4679:Glmn UTSW 5 107561075 missense probably damaging 1.00
R5140:Glmn UTSW 5 107570200 missense probably damaging 0.99
R5215:Glmn UTSW 5 107561886 missense probably benign 0.03
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6116:Glmn UTSW 5 107557340 missense probably damaging 1.00
R6671:Glmn UTSW 5 107549414 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGCTACAAAAGAGCAGCTGC -3'
(R):5'- AGCTGTTGTCAGTCCACAG -3'

Sequencing Primer
(F):5'- CTGCACACAGGACAGGTG -3'
(R):5'- CTGTTGTCAGTCCACAGATGGGAG -3'
Posted On2016-05-10