Incidental Mutation 'R4992:Dennd5a'
ID386258
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109894712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1262 (S1262P)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080437
AA Change: S1262P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: S1262P

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: S1238P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: S1238P

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156858
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAACTTGCTTAGGTCCC -3'
(R):5'- CTCCTTTAGAGGGAATTGGGGC -3'

Sequencing Primer
(F):5'- ACAACTTGCTTAGGTCCCTTTGG -3'
(R):5'- GAGGGGTACAGCTTCTTCATCC -3'
Posted On2016-05-10