Incidental Mutation 'R4992:Parp14'
ID386302
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35841142 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1479 (C1479S)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: C1479S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: C1479S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATGCTCTTGATCATGCCC -3'
(R):5'- TCCTAACCTTGATGTTGAAGGGAG -3'

Sequencing Primer
(F):5'- GAATGCTCTTGATCATGCCCTCAATC -3'
(R):5'- CCTTGATGTTGAAGGGAGTAAAAG -3'
Posted On2016-05-10