Incidental Mutation 'R4640:Adgrl4'
ID386313
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4640 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 151500310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977] [ENSMUST00000196970]
Predicted Effect probably benign
Transcript: ENSMUST00000046977
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155652
Predicted Effect probably benign
Transcript: ENSMUST00000196970
SMART Domains Protein: ENSMUSP00000143744
Gene: ENSMUSG00000039167

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 21 57 4.5e-2 SMART
EGF_CA 58 107 2.5e-11 SMART
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGGCTGAGCTCTCTC -3'
(R):5'- CAGGCCTTACCCAAGTCAGTAG -3'

Sequencing Primer
(F):5'- GAGCTCTCTCTGATGGATATAGTCAC -3'
(R):5'- GGCCTTACCCAAGTCAGTAGAATTC -3'
Posted On2016-05-11