Incidental Mutation 'R4659:Pitrm1'
ID386384
Institutional Source Beutler Lab
Gene Symbol Pitrm1
Ensembl Gene ENSMUSG00000021193
Gene Namepitrilysin metallepetidase 1
SynonymsNtup1, PreP, 2310012C15Rik, MP-1
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location6548149-6580515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6553182 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 88 (S88R)
Ref Sequence ENSEMBL: ENSMUSP00000021611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021611] [ENSMUST00000221911] [ENSMUST00000222485]
Predicted Effect probably benign
Transcript: ENSMUST00000021611
AA Change: S88R

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021611
Gene: ENSMUSG00000021193
AA Change: S88R

DomainStartEndE-ValueType
Pfam:Peptidase_M16 93 188 1.8e-7 PFAM
Pfam:Peptidase_M16_C 244 431 4.7e-27 PFAM
M16C_associated 504 752 2.8e-114 SMART
Pfam:Peptidase_M16_C 771 958 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220454
Predicted Effect probably benign
Transcript: ENSMUST00000221120
Predicted Effect probably benign
Transcript: ENSMUST00000221911
Predicted Effect probably benign
Transcript: ENSMUST00000222485
AA Change: S89R

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent metalloprotease that degrades post-cleavage mitochondrial transit peptides. The encoded protein binds zinc and can also degrade amyloid beta A4 protein, suggesting a possible role in Alzheimer's disease. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show complete preweaning lethality. Heterozygotes show progressive ataxia, neurodegeneration, and accumulation of amyloid beta deposits. Mitochondria show impaired degradation rate of amyloid beta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Pitrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pitrm1 APN 13 6568666 missense probably damaging 1.00
IGL01148:Pitrm1 APN 13 6573105 missense probably benign
IGL01408:Pitrm1 APN 13 6573042 missense probably damaging 1.00
IGL01557:Pitrm1 APN 13 6552684 missense probably benign 0.37
IGL01803:Pitrm1 APN 13 6579435 missense probably benign 0.00
IGL02111:Pitrm1 APN 13 6573145 missense probably benign 0.45
IGL02217:Pitrm1 APN 13 6567341 splice site probably benign
IGL02539:Pitrm1 APN 13 6568756 missense probably benign 0.26
IGL02935:Pitrm1 APN 13 6553264 missense probably damaging 1.00
IGL03028:Pitrm1 APN 13 6574393 missense probably benign 0.00
IGL03112:Pitrm1 APN 13 6565008 missense probably benign 0.10
FR4737:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
FR4976:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
R0078:Pitrm1 UTSW 13 6575032 missense probably damaging 0.99
R0085:Pitrm1 UTSW 13 6549568 splice site probably benign
R0089:Pitrm1 UTSW 13 6555639 missense probably damaging 1.00
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0478:Pitrm1 UTSW 13 6559395 missense probably damaging 0.99
R0496:Pitrm1 UTSW 13 6568714 missense probably damaging 1.00
R0781:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1061:Pitrm1 UTSW 13 6555575 missense probably damaging 0.99
R1110:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1170:Pitrm1 UTSW 13 6552744 splice site probably benign
R1373:Pitrm1 UTSW 13 6570700 missense probably benign 0.03
R1563:Pitrm1 UTSW 13 6563470 missense possibly damaging 0.85
R1897:Pitrm1 UTSW 13 6560095 missense possibly damaging 0.78
R1985:Pitrm1 UTSW 13 6558184 missense probably damaging 1.00
R2075:Pitrm1 UTSW 13 6555383 missense probably damaging 1.00
R2114:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2115:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2206:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2207:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2260:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R2568:Pitrm1 UTSW 13 6575092 missense probably benign 0.15
R3409:Pitrm1 UTSW 13 6578481 missense possibly damaging 0.81
R3756:Pitrm1 UTSW 13 6558235 missense probably damaging 1.00
R4020:Pitrm1 UTSW 13 6556687 missense probably damaging 1.00
R4327:Pitrm1 UTSW 13 6579773 utr 3 prime probably benign
R4540:Pitrm1 UTSW 13 6555470 critical splice donor site probably null
R4579:Pitrm1 UTSW 13 6558225 missense probably benign 0.05
R4685:Pitrm1 UTSW 13 6556542 missense probably benign 0.00
R4888:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R5072:Pitrm1 UTSW 13 6553190 missense probably damaging 1.00
R5159:Pitrm1 UTSW 13 6567471 missense probably benign 0.00
R5383:Pitrm1 UTSW 13 6577432 missense probably damaging 1.00
R5470:Pitrm1 UTSW 13 6553270 missense probably benign 0.07
R5606:Pitrm1 UTSW 13 6560065 missense probably damaging 1.00
R6224:Pitrm1 UTSW 13 6565054 missense probably damaging 1.00
R6302:Pitrm1 UTSW 13 6560061 missense probably damaging 0.99
R6898:Pitrm1 UTSW 13 6555459 missense probably damaging 1.00
R7021:Pitrm1 UTSW 13 6578557 missense probably damaging 0.99
R7249:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R7256:Pitrm1 UTSW 13 6556597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAAGATCTATGGATTCGTC -3'
(R):5'- CAGGGTCCTTTCAGCAAAATCTTG -3'

Sequencing Primer
(F):5'- TGGATTCGTCTAAAGATTCTCTCG -3'
(R):5'- GCTGGCATATGCAATAGTGTC -3'
Posted On2016-05-20