Incidental Mutation 'R4592:Smarcd3'
ID386394
Institutional Source Beutler Lab
Gene Symbol Smarcd3
Ensembl Gene ENSMUSG00000028949
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
SynonymsBAF60C, 1500001J14Rik, 2210409C08Rik
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24590818-24624411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24592804 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 467 (I467V)
Ref Sequence ENSEMBL: ENSMUSP00000030791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
AA Change: I467V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949
AA Change: I467V

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably benign
Transcript: ENSMUST00000121863
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect probably benign
Transcript: ENSMUST00000195943
AA Change: I438V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949
AA Change: I438V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198521
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Smarcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Smarcd3 APN 5 24593719 missense probably damaging 1.00
R0135:Smarcd3 UTSW 5 24595499 unclassified probably benign
R1614:Smarcd3 UTSW 5 24594876 missense possibly damaging 0.93
R1617:Smarcd3 UTSW 5 24595194 missense probably damaging 1.00
R1753:Smarcd3 UTSW 5 24595822 nonsense probably null
R1879:Smarcd3 UTSW 5 24593021 missense probably damaging 0.99
R2307:Smarcd3 UTSW 5 24595748 missense probably damaging 1.00
R3800:Smarcd3 UTSW 5 24593227 nonsense probably null
R6369:Smarcd3 UTSW 5 24594984 missense probably damaging 0.99
R6388:Smarcd3 UTSW 5 24596026 missense possibly damaging 0.94
R7077:Smarcd3 UTSW 5 24594962 missense probably damaging 1.00
R7078:Smarcd3 UTSW 5 24593069 missense probably damaging 0.98
R7341:Smarcd3 UTSW 5 24595437 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACGTGACCTTTAATCCATCCAGC -3'
(R):5'- AGCCGCTACTTCTACTGTAAGG -3'

Sequencing Primer
(F):5'- GACCTTTAATCCATCCAGCCCTCC -3'
(R):5'- ACTTCTACTGTAAGGTAATGGAGGCC -3'
Posted On2016-05-24