Incidental Mutation 'R4654:Tln1'
ID386415
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43535954 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2077 (Q2077L)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000030187
AA Change: Q2077L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: Q2077L

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCCACCTTGGCAGAGTTC -3'
(R):5'- GGTATCTTAAAGACAGCAAAGGTTC -3'

Sequencing Primer
(F):5'- AGAGTTCTTGAGCTGCCACACTG -3'
(R):5'- CTTAAAGACAGCAAAGGTTCTTGTGG -3'
Posted On2016-05-26