Incidental Mutation 'R4697:Mlc1'
ID386442
Institutional Source Beutler Lab
Gene Symbol Mlc1
Ensembl Gene ENSMUSG00000035805
Gene Namemegalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
SynonymsWKL1, Kiaa0027-hp
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4697 (G1)
Quality Score214
Status Validated
Chromosome15
Chromosomal Location88955884-88979007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88974777 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 102 (C102R)
Ref Sequence ENSEMBL: ENSMUSP00000104993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042594] [ENSMUST00000109368]
Predicted Effect probably damaging
Transcript: ENSMUST00000042594
AA Change: C96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047667
Gene: ENSMUSG00000035805
AA Change: C96R

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 266 288 N/A INTRINSIC
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109368
AA Change: C102R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104993
Gene: ENSMUSG00000035805
AA Change: C102R

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit myelin vacuolization that progresses with age, and show alterations in glial cell and oligodendrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Mlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Mlc1 APN 15 88974718 splice site probably benign
IGL03251:Mlc1 APN 15 88974731 missense possibly damaging 0.88
R0710:Mlc1 UTSW 15 88977864 missense possibly damaging 0.88
R1037:Mlc1 UTSW 15 88965461 missense probably damaging 1.00
R1573:Mlc1 UTSW 15 88958147 missense probably damaging 1.00
R1994:Mlc1 UTSW 15 88974579 missense possibly damaging 0.50
R2121:Mlc1 UTSW 15 88963431 missense probably benign 0.22
R2302:Mlc1 UTSW 15 88965437 missense possibly damaging 0.63
R3110:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3112:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3117:Mlc1 UTSW 15 88976528 missense probably damaging 1.00
R4027:Mlc1 UTSW 15 88966494 missense probably benign 0.29
R4450:Mlc1 UTSW 15 88963490 missense probably benign 0.19
R4576:Mlc1 UTSW 15 88974537 missense probably damaging 1.00
R4728:Mlc1 UTSW 15 88978031 intron probably null
R4910:Mlc1 UTSW 15 88958212 missense possibly damaging 0.94
R5618:Mlc1 UTSW 15 88974566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCGAACGTGGAAAC -3'
(R):5'- GAAGCTTGAACATTGCAACACATG -3'

Sequencing Primer
(F):5'- CAATATCTGAAAGTTGGGAATCTGG -3'
(R):5'- GAACATTGCAACACATGATTGTC -3'
Posted On2016-06-01