Incidental Mutation 'R5059:Gon4l'
ID386500
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 042649-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R5059 (G1)
Quality Score171
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88900012 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1671 (M1671K)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
AA Change: M1671K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: M1671K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090942
AA Change: M1672K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: M1672K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107498
AA Change: M1671K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: M1671K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b T A 8: 43,520,600 N455I probably damaging Het
Alg12 A G 15: 88,811,456 F279S probably damaging Het
Angpt4 A G 2: 151,934,440 D296G probably damaging Het
Ank1 T A 8: 23,096,188 S437T probably damaging Het
Apol7a G A 15: 77,389,812 probably benign Het
Arhgef38 T A 3: 133,137,414 Y465F probably damaging Het
Atp8a2 T G 14: 59,691,537 T1023P probably benign Het
Cdh7 C A 1: 110,065,700 A295E probably damaging Het
Cela3b T C 4: 137,424,870 E92G probably benign Het
Cntnap5a T C 1: 116,428,494 S752P probably benign Het
Dlx2 T C 2: 71,546,241 H51R probably damaging Het
Dnm2 T C 9: 21,504,578 I736T probably damaging Het
Dst A G 1: 34,163,346 T252A possibly damaging Het
Fbxo40 T C 16: 36,970,296 R151G possibly damaging Het
Gapdhs C T 7: 30,731,985 A357T probably benign Het
Gm13101 A G 4: 143,964,995 V386A probably damaging Het
Gpi1 T C 7: 34,207,688 Y327C probably damaging Het
Gucy2g T C 19: 55,226,071 R542G probably benign Het
Hectd3 A G 4: 116,997,164 K308E possibly damaging Het
Hip1 A G 5: 135,449,821 F178S probably damaging Het
Hydin A G 8: 110,505,769 D1640G probably damaging Het
Il18r1 G A 1: 40,481,067 probably null Het
Kdm3b T C 18: 34,777,197 S23P possibly damaging Het
Lactb T C 9: 66,975,144 E83G probably benign Het
Larp4 A T 15: 100,005,290 D414V probably damaging Het
Map2k5 T C 9: 63,257,014 H336R probably benign Het
Mast4 T C 13: 102,750,563 E1006G probably damaging Het
Mbd5 T C 2: 49,256,455 S226P probably damaging Het
Micall1 A T 15: 79,122,834 probably benign Het
Mtpap T A 18: 4,375,827 probably benign Het
Olfr482 A G 7: 108,095,315 L85P probably damaging Het
Olfr608 A T 7: 103,470,281 K81* probably null Het
Pnrc1 G A 4: 33,246,072 Q296* probably null Het
Poc1a G T 9: 106,349,813 probably benign Het
Prkcsh T A 9: 22,012,750 L439Q probably damaging Het
Prkdc T C 16: 15,838,018 L3970P probably damaging Het
Ptcd1 G A 5: 145,152,224 P542L probably benign Het
Rps6ka5 G A 12: 100,554,375 T631I probably damaging Het
Rxfp1 T C 3: 79,663,312 N271S probably benign Het
Taf6 A G 5: 138,179,447 M541T probably benign Het
Tek T A 4: 94,804,314 C169S probably benign Het
Tgfbr3l T A 8: 4,249,343 probably null Het
Trpv3 A G 11: 73,295,323 N647D probably benign Het
Ube3c A G 5: 29,631,295 K638R probably null Het
Vmn1r191 G A 13: 22,178,993 A197V probably damaging Het
Vmn2r6 T C 3: 64,537,623 T894A possibly damaging Het
Vstm4 T G 14: 32,863,730 Y85D probably damaging Het
Wnt7a A G 6: 91,394,500 I160T probably benign Het
Zc3h7a TAGAGAG TAGAGAGAG 16: 11,161,121 probably null Het
Zfp988 A T 4: 147,331,915 K269* probably null Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGAAGGGAGCTCTCAGAG -3'
(R):5'- CGGGAAAACTGGAACTGTCTTG -3'

Sequencing Primer
(F):5'- TCTCAGAGCCGTGTGAGCAC -3'
(R):5'- GAAAACTGGAACTGTCTTGATTGGC -3'
Posted On2016-06-06