Mutagenetix > Incidental Mutation

Incidental Mutation 'R5059:Atp8a2'

386530

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

Ib, wl, agil

MMRRC Submission

042649-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R5059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59884980-60324363 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 59928986 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1023 (T1023P)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368]

AlphaFold

P98200

Predicted Effect

probably benign
Transcript: ENSMUST00000080368
AA Change: T1023P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: T1023P

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	T	A	8: 43,973,637 (GRCm39)	N455I	probably damaging	Het
Alg12	A	G	15: 88,695,659 (GRCm39)	F279S	probably damaging	Het
Angpt4	A	G	2: 151,776,360 (GRCm39)	D296G	probably damaging	Het
Ank1	T	A	8: 23,586,204 (GRCm39)	S437T	probably damaging	Het
Apol7a	G	A	15: 77,274,012 (GRCm39)		probably benign	Het
Arhgef38	T	A	3: 132,843,175 (GRCm39)	Y465F	probably damaging	Het
Cdh20	C	A	1: 109,993,430 (GRCm39)	A295E	probably damaging	Het
Cela3b	T	C	4: 137,152,181 (GRCm39)	E92G	probably benign	Het
Cntnap5a	T	C	1: 116,356,224 (GRCm39)	S752P	probably benign	Het
Dlx2	T	C	2: 71,376,585 (GRCm39)	H51R	probably damaging	Het
Dnm2	T	C	9: 21,415,874 (GRCm39)	I736T	probably damaging	Het
Dst	A	G	1: 34,202,427 (GRCm39)	T252A	possibly damaging	Het
Fbxo40	T	C	16: 36,790,658 (GRCm39)	R151G	possibly damaging	Het
Gapdhs	C	T	7: 30,431,410 (GRCm39)	A357T	probably benign	Het
Gon4l	T	A	3: 88,807,319 (GRCm39)	M1671K	probably benign	Het
Gpi1	T	C	7: 33,907,113 (GRCm39)	Y327C	probably damaging	Het
Gucy2g	T	C	19: 55,214,503 (GRCm39)	R542G	probably benign	Het
Hectd3	A	G	4: 116,854,361 (GRCm39)	K308E	possibly damaging	Het
Hip1	A	G	5: 135,478,675 (GRCm39)	F178S	probably damaging	Het
Hydin	A	G	8: 111,232,401 (GRCm39)	D1640G	probably damaging	Het
Il18r1	G	A	1: 40,520,227 (GRCm39)		probably null	Het
Kdm3b	T	C	18: 34,910,250 (GRCm39)	S23P	possibly damaging	Het
Lactb	T	C	9: 66,882,426 (GRCm39)	E83G	probably benign	Het
Larp4	A	T	15: 99,903,171 (GRCm39)	D414V	probably damaging	Het
Map2k5	T	C	9: 63,164,296 (GRCm39)	H336R	probably benign	Het
Mast4	T	C	13: 102,887,071 (GRCm39)	E1006G	probably damaging	Het
Mbd5	T	C	2: 49,146,467 (GRCm39)	S226P	probably damaging	Het
Micall1	A	T	15: 79,007,034 (GRCm39)		probably benign	Het
Mtpap	T	A	18: 4,375,827 (GRCm39)		probably benign	Het
Or52ae7	A	T	7: 103,119,488 (GRCm39)	K81*	probably null	Het
Or5p58	A	G	7: 107,694,522 (GRCm39)	L85P	probably damaging	Het
Pnrc1	G	A	4: 33,246,072 (GRCm39)	Q296*	probably null	Het
Poc1a	G	T	9: 106,227,012 (GRCm39)		probably benign	Het
Pramel28	A	G	4: 143,691,565 (GRCm39)	V386A	probably damaging	Het
Prkcsh	T	A	9: 21,924,046 (GRCm39)	L439Q	probably damaging	Het
Prkdc	T	C	16: 15,655,882 (GRCm39)	L3970P	probably damaging	Het
Ptcd1	G	A	5: 145,089,034 (GRCm39)	P542L	probably benign	Het
Rps6ka5	G	A	12: 100,520,634 (GRCm39)	T631I	probably damaging	Het
Rxfp1	T	C	3: 79,570,619 (GRCm39)	N271S	probably benign	Het
Taf6	A	G	5: 138,177,709 (GRCm39)	M541T	probably benign	Het
Tek	T	A	4: 94,692,551 (GRCm39)	C169S	probably benign	Het
Tgfbr3l	T	A	8: 4,299,343 (GRCm39)		probably null	Het
Trpv3	A	G	11: 73,186,149 (GRCm39)	N647D	probably benign	Het
Ube3c	A	G	5: 29,836,293 (GRCm39)	K638R	probably null	Het
Vmn1r191	G	A	13: 22,363,163 (GRCm39)	A197V	probably damaging	Het
Vmn2r6	T	C	3: 64,445,044 (GRCm39)	T894A	possibly damaging	Het
Vstm4	T	G	14: 32,585,687 (GRCm39)	Y85D	probably damaging	Het
Wnt7a	A	G	6: 91,371,482 (GRCm39)	I160T	probably benign	Het
Zc3h7a	TAGAGAG	TAGAGAGAG	16: 10,978,985 (GRCm39)		probably null	Het
Zfp988	A	T	4: 147,416,372 (GRCm39)	K269*	probably null	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59,928,910 (GRCm39)	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60,265,512 (GRCm39)	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60,282,437 (GRCm39)	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60,253,317 (GRCm39)	splice site	probably benign
IGL01634:Atp8a2	APN	14	60,235,511 (GRCm39)	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59,928,982 (GRCm39)	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60,260,962 (GRCm39)	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60,263,609 (GRCm39)	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	60,094,497 (GRCm39)	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60,264,369 (GRCm39)	splice site	probably null
IGL02211:Atp8a2	APN	14	60,265,425 (GRCm39)	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60,254,248 (GRCm39)	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	60,235,451 (GRCm39)	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60,249,907 (GRCm39)	splice site	probably benign
IGL02795:Atp8a2	APN	14	60,271,191 (GRCm39)	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	60,039,701 (GRCm39)	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	60,162,571 (GRCm39)	nonsense	probably null
IGL03307:Atp8a2	APN	14	60,253,321 (GRCm39)	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	60,011,460 (GRCm39)	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59,892,075 (GRCm39)	missense	probably benign
R0334:Atp8a2	UTSW	14	59,928,961 (GRCm39)	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	60,097,661 (GRCm39)	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	60,011,193 (GRCm39)	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60,260,593 (GRCm39)	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60,247,330 (GRCm39)	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	60,031,378 (GRCm39)	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	60,097,772 (GRCm39)	splice site	probably benign
R1472:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	60,097,655 (GRCm39)	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	60,028,632 (GRCm39)	missense	probably benign
R1661:Atp8a2	UTSW	14	60,097,635 (GRCm39)	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	60,028,689 (GRCm39)	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	60,097,623 (GRCm39)	nonsense	probably null
R1796:Atp8a2	UTSW	14	60,258,207 (GRCm39)	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60,324,073 (GRCm39)	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60,243,815 (GRCm39)	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	60,097,719 (GRCm39)	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	60,162,457 (GRCm39)	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	60,097,641 (GRCm39)	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59,928,914 (GRCm39)	frame shift	probably null
R3621:Atp8a2	UTSW	14	60,263,587 (GRCm39)	splice site	probably null
R3768:Atp8a2	UTSW	14	60,281,785 (GRCm39)	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	60,011,415 (GRCm39)	missense	probably damaging	1.00
R3896:Atp8a2	UTSW	14	60,263,589 (GRCm39)	critical splice donor site	probably null
R4009:Atp8a2	UTSW	14	60,265,434 (GRCm39)	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59,892,078 (GRCm39)	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59,928,916 (GRCm39)	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60,245,918 (GRCm39)	nonsense	probably null
R5529:Atp8a2	UTSW	14	60,031,314 (GRCm39)	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60,258,242 (GRCm39)	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60,281,775 (GRCm39)	missense	probably benign
R6295:Atp8a2	UTSW	14	60,249,848 (GRCm39)	nonsense	probably null
R6393:Atp8a2	UTSW	14	60,011,204 (GRCm39)	nonsense	probably null
R6454:Atp8a2	UTSW	14	60,245,948 (GRCm39)	splice site	probably null
R6651:Atp8a2	UTSW	14	60,011,470 (GRCm39)	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60,245,857 (GRCm39)	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60,284,171 (GRCm39)	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60,249,859 (GRCm39)	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60,255,289 (GRCm39)	splice site	probably null
R7243:Atp8a2	UTSW	14	59,885,291 (GRCm39)	missense	probably benign
R7352:Atp8a2	UTSW	14	60,028,653 (GRCm39)	missense	probably benign
R7355:Atp8a2	UTSW	14	60,282,453 (GRCm39)	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59,892,043 (GRCm39)	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	60,028,630 (GRCm39)	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60,245,824 (GRCm39)	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	60,094,516 (GRCm39)	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	60,011,202 (GRCm39)	missense	probably damaging	0.99
R8116:Atp8a2	UTSW	14	60,263,657 (GRCm39)	missense	probably damaging	1.00
R8171:Atp8a2	UTSW	14	60,283,493 (GRCm39)	missense	probably damaging	1.00
R8504:Atp8a2	UTSW	14	59,885,366 (GRCm39)	nonsense	probably null
R8516:Atp8a2	UTSW	14	59,928,921 (GRCm39)	missense	probably benign	0.00
R8552:Atp8a2	UTSW	14	60,011,431 (GRCm39)	missense	probably benign	0.00
R8852:Atp8a2	UTSW	14	60,162,545 (GRCm39)	missense	probably damaging	1.00
R9367:Atp8a2	UTSW	14	60,249,827 (GRCm39)	critical splice donor site	probably null
R9469:Atp8a2	UTSW	14	60,028,668 (GRCm39)	missense	probably benign	0.32
R9691:Atp8a2	UTSW	14	60,245,829 (GRCm39)	missense	probably damaging	0.96
R9709:Atp8a2	UTSW	14	60,271,187 (GRCm39)	missense	probably damaging	0.98
Z1088:Atp8a2	UTSW	14	60,265,419 (GRCm39)	missense	probably benign
Z1177:Atp8a2	UTSW	14	60,243,779 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGGAGTCCTGTTTCTTCTGC -3'
(R):5'- TCCAGAGGGAGCTTGAAGTTCC -3'

Sequencing Primer
(F):5'- GAGTCCTGTTTCTTCTGCATCCC -3'
(R):5'- GTTCCAAAGCAGAGACAAGGTCTTAC -3'

Posted On

2016-06-06