Incidental Mutation 'R5060:Unc5d'
ID386564
Institutional Source Beutler Lab
Gene Symbol Unc5d
Ensembl Gene ENSMUSG00000063626
Gene Nameunc-5 netrin receptor D
SynonymsUnc5h4, D930029E11Rik
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location28646717-29219636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28719695 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 466 (S466T)
Ref Sequence ENSEMBL: ENSMUSP00000147306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168630] [ENSMUST00000209401] [ENSMUST00000210298] [ENSMUST00000210785] [ENSMUST00000211448]
Predicted Effect probably benign
Transcript: ENSMUST00000168630
AA Change: S538T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128521
Gene: ENSMUSG00000063626
AA Change: S538T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1cs6a2 52 146 5e-3 SMART
IGc2 169 236 2.66e-8 SMART
TSP1 253 304 2.29e-13 SMART
TSP1 309 358 6.33e-7 SMART
transmembrane domain 383 405 N/A INTRINSIC
Pfam:ZU5 545 642 1.6e-33 PFAM
DEATH 850 941 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209401
AA Change: S464T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000210298
AA Change: S477T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000210785
AA Change: S520T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000211448
AA Change: S466T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice exhibit impaired induced growth cone collapse response and accelerated radial migration of cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Unc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Unc5d APN 8 28719826 missense probably damaging 0.97
IGL00687:Unc5d APN 8 28715813 splice site probably benign
IGL00970:Unc5d APN 8 28696428 missense probably benign 0.15
IGL01992:Unc5d APN 8 28652791 missense probably damaging 0.98
IGL02024:Unc5d APN 8 28652827 missense probably benign 0.08
IGL02080:Unc5d APN 8 28891288 splice site probably null
IGL02902:Unc5d APN 8 28875606 missense probably damaging 1.00
IGL02982:Unc5d APN 8 28652853 missense probably damaging 1.00
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0761:Unc5d UTSW 8 28696532 intron probably null
R0941:Unc5d UTSW 8 28759027 missense possibly damaging 0.85
R1086:Unc5d UTSW 8 28875630 missense possibly damaging 0.87
R1625:Unc5d UTSW 8 28683206 missense probably damaging 1.00
R1635:Unc5d UTSW 8 28760749 missense probably benign 0.14
R1682:Unc5d UTSW 8 28759081 missense probably damaging 1.00
R1698:Unc5d UTSW 8 28696478 missense probably damaging 0.99
R2015:Unc5d UTSW 8 28758979 missense probably damaging 1.00
R2132:Unc5d UTSW 8 28875529 missense possibly damaging 0.50
R2174:Unc5d UTSW 8 28694540 missense probably damaging 0.99
R2210:Unc5d UTSW 8 28761797 missense probably damaging 0.97
R3684:Unc5d UTSW 8 28694592 missense probably damaging 1.00
R3734:Unc5d UTSW 8 28761798 missense probably benign 0.02
R4093:Unc5d UTSW 8 28844837 missense possibly damaging 0.87
R4287:Unc5d UTSW 8 28719796 missense probably benign 0.00
R4888:Unc5d UTSW 8 28666899 missense probably benign 0.02
R5000:Unc5d UTSW 8 28715747 missense possibly damaging 0.90
R5076:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
R5696:Unc5d UTSW 8 28666842 missense probably benign 0.06
R6024:Unc5d UTSW 8 28875511 missense possibly damaging 0.96
R6077:Unc5d UTSW 8 28675307 missense possibly damaging 0.94
R6259:Unc5d UTSW 8 28666792 missense probably benign 0.00
R6387:Unc5d UTSW 8 28875526 nonsense probably null
R7038:Unc5d UTSW 8 28715721 critical splice donor site probably null
X0058:Unc5d UTSW 8 28760730 missense probably benign 0.12
X0060:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTCAGCTGCACATCTGGGC -3'
(R):5'- GCTCATGACAGAGTCCTCAC -3'

Sequencing Primer
(F):5'- TGCACATCTGGGCTCCTG -3'
(R):5'- GAGTCCTCACTCTTCAATCCTTTATC -3'
Posted On2016-06-06