Incidental Mutation 'R5061:Hsd11b1'
ID386589
Institutional Source Beutler Lab
Gene Symbol Hsd11b1
Ensembl Gene ENSMUSG00000016194
Gene Namehydroxysteroid 11-beta dehydrogenase 1
Synonyms11beta-hydroxysteroid dehydrogenase type 1, 11beta-HSD-1
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193221634-193264075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193242245 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 6 (N6K)
Ref Sequence ENSEMBL: ENSMUSP00000125620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016338] [ENSMUST00000159644] [ENSMUST00000160929] [ENSMUST00000161737] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016338
AA Change: N6K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016338
Gene: ENSMUSG00000016194
AA Change: N6K

DomainStartEndE-ValueType
Pfam:adh_short 35 230 1.1e-53 PFAM
Pfam:KR 36 215 2.4e-9 PFAM
Pfam:adh_short_C2 41 248 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159644
AA Change: N6K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124693
Gene: ENSMUSG00000016194
AA Change: N6K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:adh_short 47 214 2.1e-32 PFAM
Pfam:KR 48 223 1.6e-10 PFAM
Pfam:adh_short_C2 53 221 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160929
SMART Domains Protein: ENSMUSP00000123849
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 5 172 1.5e-32 PFAM
Pfam:KR 6 184 8.2e-11 PFAM
Pfam:adh_short_C2 11 218 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161406
SMART Domains Protein: ENSMUSP00000124142
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 72 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161737
AA Change: N6K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125620
Gene: ENSMUSG00000016194
AA Change: N6K

DomainStartEndE-ValueType
Pfam:adh_short 35 202 2.6e-32 PFAM
Pfam:KR 36 216 1.7e-10 PFAM
Pfam:adh_short_C2 41 248 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162842
SMART Domains Protein: ENSMUSP00000124715
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 132 4.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191977
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display improved glucose tolerance and lower circulating lipid levels. Mice homozygous for a different targeted allele exhibit decreased susceptibility to weight gain, adiposis or hyperinsulinemia induced by 11-DHC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Hsd11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Hsd11b1 APN 1 193241458 start codon destroyed probably null 0.43
IGL00969:Hsd11b1 APN 1 193223644 nonsense probably null
IGL02068:Hsd11b1 APN 1 193222046 nonsense probably null
IGL02331:Hsd11b1 APN 1 193240616 missense probably damaging 1.00
H8786:Hsd11b1 UTSW 1 193240252 missense probably benign 0.30
R0207:Hsd11b1 UTSW 1 193240248 missense probably damaging 1.00
R0267:Hsd11b1 UTSW 1 193241397 missense probably damaging 1.00
R0334:Hsd11b1 UTSW 1 193242168 intron probably benign
R0591:Hsd11b1 UTSW 1 193229676 intron probably benign
R1244:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R1569:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1570:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1892:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R2021:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2022:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2023:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R5531:Hsd11b1 UTSW 1 193240249 frame shift probably null
R5768:Hsd11b1 UTSW 1 193240246 missense probably damaging 0.99
R5793:Hsd11b1 UTSW 1 193242184 missense probably damaging 1.00
R5795:Hsd11b1 UTSW 1 193240632 missense possibly damaging 0.85
R6359:Hsd11b1 UTSW 1 193242352 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGTGGCTGGAGGATACAG -3'
(R):5'- TTGCTCTGACAGGGAAGTTG -3'

Sequencing Primer
(F):5'- CAGGGTTACAGATTCAACATTAGG -3'
(R):5'- GGCTAGTGCTGCCTGAGACTAC -3'
Posted On2016-06-06